 |
Claims  |
|
|
What is claimed is:
1. A recombinant DNA transfer vector comprising codons for human chorionic
somatomammotropin comprising the nucleotide sequence:
5'-G GCL.sub.24 ATM.sub.25 GAK.sub.26 ACL.sub.27 TAK.sub.28 CAJ.sub.29
GAJ.sub.30 TTK.sub.31 GAJ.sub.32 GAJ.sub.33 ACL.sub.34 TAK.sub.35
ATM.sub.36 CCL.sub.37 AAJ.sub.38 GAK.sub.39 CAJ.sub.40 AAJ.sub.41
TAK.sub.42 QR.sub.43 S.sub.43 TTK.sub.44 X.sub.45 TY.sub.45 CAK.sub.46
GAK.sub.47 QR.sub.48 S.sub.48 CAJ.sub.49 ACL.sub.50 QR.sub.51 S.sub.51
TTK.sub.52 TGK.sub.53 TTK.sub.54 QR.sub.55 S.sub.55 GAK.sub.56 QR.sub.57
S.sub.57 ATM.sub.58 CCL.sub.59 ACL.sub.60 CCL.sub.61 QR.sub.62 S.sub.62
AAK.sub.63 ATGGAJ.sub.65 GAJ.sub.66 ACL.sub.67 CAJ.sub.68 CAJ.sub.69
AAJ.sub.70 QR.sub.71 S.sub.71 AAK.sub.72 X.sub.73 TY.sub.73 GAJ.sub.74
X.sub.75 TY.sub.75 X.sub.76 TY.sub.76 W.sub.77 GZ.sub.77 ATM.sub.78
QR.sub.79 S.sub.79 X.sub.80 TY.sub.80 X.sub.81 TY.sub.81 X.sub.82
TY.sub.82 ATM.sub.83 GAJ.sub.84 QR.sub.85 S.sub.85 TGGX.sub.87 TY.sub.87
GAJ.sub.88 CCL.sub.89 GTL.sub.90 W.sub.91 GZ.sub.91 TTK.sub.92 X.sub.93
TY.sub.93 W.sub.94 GZ.sub.94 QR.sub.95 S.sub.95 ATGTTK.sub.97 GCL.sub.98
AAK.sub.99 AAK.sub.100 X.sub.101 TY.sub. 101 GTL.sub.102 TAK.sub.103
GAK.sub.104 ACL.sub.105 QR.sub.106 S.sub.106 GAK.sub.107 QR.sub.108
S.sub.108 GAK.sub.109 GAK.sub.110 TAK.sub.111 CAK.sub.112 X.sub.113
TY.sub.113 X.sub.114 TY.sub.114 AAJ.sub.115 GAK.sub.116 X.sub.117
TY.sub.117 GAJ.sub.118 GAJ.sub.119 GGL.sub.120 ATM.sub.121 CAJ.sub.122
ACL.sub.123 X.sub.124 TY.sub.124 ATGGGL.sub.126 W.sub.127 GZ.sub.127
X.sub.128 TY.sub.128 GAJ.sub.129 GAK.sub.130 GGL.sub.131 QR.sub.132
S.sub.132 W.sub.133 GZ.sub.133 W.sub.134 GZ.sub.134 ACL.sub.135
GGL.sub.136 CAJ.sub.137 ATM.sub.138 X.sub.139 TY.sub.139 AAJ.sub.140
CAJ.sub.141 ACL.sub.142 TAK.sub.143 QR.sub.144 S.sub.144 AAJ.sub.145
TTK.sub.146 GAK.sub.147 ACL.sub.148 AAK.sub.149 QR.sub.150 S.sub.150
CAK.sub.151 AAK.sub.152 CAK.sub.153 GAK.sub.154 GCL.sub.155 X.sub.156
TY.sub.156 X.sub.157 TY.sub.157 AAJ.sub.158 AAK.sub.159 TAK.sub.160
GGL.sub.161 X.sub.162 TY.sub.162 X.sub.163 TY.sub.163 TAK.sub.164
TGK.sub.165 TTK.sub.166 W.sub.167 GZ.sub.167 AAJ.sub.168 GAK.sub.169
ATGGAK.sub.171 AAJ.sub.172 GTL.sub.173 GAJ.sub.174 ACL.sub.175 TTK.sub.176
X.sub.177 TY.sub.177 W.sub.178 GZ.sub.178 ATGGTL.sub.180 CAJ.sub.181
TGK.sub.182 W.sub. 183 GZ.sub.183 QR.sub.184 S.sub.184 GTL.sub.185
GAJ.sub.186 GGL.sub.187 QR.sub.188 S.sub.188 TGK.sub.189 GGL.sub.190
TTK.sub.191 TAGGTGCCCGAGTAGCATCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCC-3' wherein
A is deoxyadenyl,
G is deoxyguanyl,
C is deoxycytosyl,
T is thymidyl,
J is A or G;
K is T or C;
L is A,T,C or G;
M is A, C or T;
X is T or C, if the succeeding Y is A or G, and C if the succeeding Y is C
or T;
Y is A, G, C or T, if the preceding X is C, and A or G if the preceding X
is T;
W is C or A, if the succeeding Z is G or A, and C if the succeeding Z is C
or T;
Z is A, G, C or T, if the preceding W is C, and A or G if the preceding W
is A;
QR is TC, if the succeeding S is A, G, C or T, and AG if the succeeding S
is T or C;
S is A, G, C or T, if the preceding QR is TC, and T or C if the preceding
QR is AG and subscript numerals refer to the amino acid position in human
growth hormone, for which the nucleotide sequence corresponds, according
to the genetic code, the amino acid positions being numbered from the
amino end.
2. The recombinant DNA transfer vector of claim 1 wherein
J is A in amino acid positions: 32, 33, 66, 68, 70, 119, 122 and 129,
J is G in amino acid positions: 29, 30, 38, 40, 41, 49, 65, 69, 74, 84, 88,
115, 118, 137, 140, 141, 145, 158, 168, 172, 174, 181 and 186;
K is T in amino acid positions: 31, 35, 42, 46, 72, 103, 109, 111, 146, 153
and 189;
K is C in amino acid positions: 26, 28, 39, 44, 47, 52, 53, 54, 56, 63, 92,
97, 99, 100, 104, 107, 110, 112, 116, 130, 143, 147, 149, 151, 152, 154,
159, 160, 164, 165, 166, 169, 171, 176, 182 and 191;
L is A in amino acid positions: 37, 60, 148, 155 and 175;
L is T in amino acid position: 135;
L is G in amino acid positions: 59, 67, 90, 102, 123, 126, 136, 161, 180
and 185;
L is C in amino acid positions: 24, 27, 34, 50, 61, 89, 98, 105, 120, 131,
142, 173, 187 and 190;
M is T in amino acid positions: 25 and 58;
M is C in amino acid positions: 36, 78, 83, 121 and 138;
X is C;
Y is A in amino acid positions: 73, 114 and 117;
Y is G in amino acid positions: 45, 75, 80, 81, 87, 101, 124, 128, 156, 162
and 177;
Y is C in amino acid positions: 76, 82, 93, 113, 139, 157 and 163;
W is A in amino acid positions: 94, 127 and 167;
W is C in amino acid positions: 77, 91, 133, 134, 178 and 183;
Z is G in amino acid positions: 91, 94, 127, 134 and 167;
Z is C in amino acid positions: 77, 133, 178 and 183;
QR is AG in amino acid positions: 95, 108, 132, 144 and 188;
QR is TC in amino acid positions: 43, 48, 51, 55, 57, 62, 71, 79, 85, 106,
150 and 184;
S is A in amino acid position: 55;
S is T in amino acid positions: 57, 95 and 184;
S is G in amino acid positions: 43, 85, 106 and 150; and
S is C in amino acid positions: 48, 51, 62, 71, 79, 108, 132, 144 and 188.
3. A recombinant DNA transfer vector according to claim 1 comprising in the
nucleotide sequence, 5'-GTL.sub.1 CAJ.sub.2 ACL.sub.3 GTL.sub.4 CCL.sub.5
X.sub.6 TY.sub.6 QR.sub.7 S.sub.7 W.sub.8 GZ.sub.8 X.sub.9 TY.sub.9
TTK.sub.10 GAK.sub.11 CAK.sub.12 GCL.sub.13 ATGX.sub.15 TY.sub.15
CAJ.sub.16 GCL.sub.17 CAK.sub.18 W.sub.19 GZ.sub.19 GCL.sub.20 CAK.sub.21
CAJ.sub.22 X.sub.23 TY.sub.23 wherein Y.sub.23 is followed by GCL.sub.24
in the sequence of claim 15.
4. A recombinant plasmid vector comprising the nucleotide sequence coding
for the growth hormone of an animal species and capable of transforming a
microorganism, synthesized by a process comprising:
isolating polyadenylated RNA from pituitary cells of the animal species,
preparing double-stranded cDNA transcripts of the isolated RNA,
fractionating the cDNA according to its molecular length, in order to
produce a fraction enriched for cDNA coding for the growth hormone of the
animal species,
joining the cDNA coding for growth hormone covalently with a plasmid vector
to produce a recombinant plasmid capable of transforming a microorganism.
5. A recombinant DNA transfer vector according to claim 2 wherein the
transfer vector comprises the plasmid pMB-9.
6. A recombinant DNA transfer vector comprising codons for human growth
hormone, comprising the nucleotide sequence:
5'-G GCL.sub.24 TTK.sub.25 GAK.sub.26 ACL.sub.27 TAK.sub.28 CAJ.sub.29
GAJ.sub.30 TTK.sub.31 GAJ.sub.32 GAJ.sub.33 ACL.sub.34 TAK.sub.35
ATM.sub.36 CCL.sub.37 AAJ.sub.38 GAJ.sub.39 CAJ.sub.40 AAJ.sub.41
TAK.sub.42 QR.sub.43 S.sub.43 TTK.sub.44 X.sub.45 TY.sub.45 CAJ.sub.46
AAK.sub.47 CCL.sub.48 CAJ.sub.49 ACL.sub.50 QR.sub.51 S.sub.51 X.sub.52
TY.sub.52 TGK.sub.53 TTK.sub.54 QR.sub.55 S.sub.55 GAJ.sub.56 QR.sub.57
S.sub.57 ATM.sub.58 CCL.sub.59 ACL.sub.60 CCL.sub.61 QR.sub.62 S.sub.62
AAK.sub.63 W.sub.64 GZ.sub.64 GAJ.sub.65 GAJ.sub.66 ACL.sub.67 CAJ.sub.68
CAJ.sub.69 AAJ.sub.70 QR.sub.71 S.sub.71 AAK.sub.72 X.sub.73 TY.sub.73
GAJ.sub.74 X.sub.75 TY.sub.75 X.sub.76 TY.sub.76 W.sub.77 GZ.sub.77
ATM.sub.78 QR.sub.79 S.sub.79 X.sub.80 TY.sub.80 X.sub.81 TY.sub.81
X.sub.82 TY.sub.82 ATM.sub.83 CAJ.sub.84 QR.sub.85 S.sub.85 TGGX.sub.87
TY.sub.87 GAJ.sub.88 CCL.sub.89 GTL.sub.90 CAJ.sub.91 TTK.sub.92 X.sub.93
TY.sub.93 W.sub.94 GZ.sub.94 QR.sub.95 S.sub.95 GTL.sub.96 TTK.sub.97
GCL.sub.98 AAK.sub.99 AAK.sub. 100 X.sub.101 TY.sub.101 GTL.sub.102
TAK.sub.103 GGL.sub.104 GCL.sub.105 QR.sub.106 S.sub.106 GAK.sub.107
QR.sub.108 S.sub.108 AAK.sub.109 GTL.sub.110 TAK.sub.111 GAK.sub.112
X.sub.113 TY.sub.113 X.sub.114 TY.sub.114 AAJ.sub.115 GAK.sub.116
X.sub.117 TY.sub.117 GAJ.sub.118 GAJ.sub.119 GGL.sub.120 ATM.sub.121
CAJ.sub.122 ACL.sub.123 X.sub.124 TY.sub.124 ATGGGL.sub.126 W.sub.127
GZ.sub.127 X.sub.128 TY.sub.128 GAJ.sub.129 GAK.sub.130 GGL.sub.131
QR.sub.132 S.sub.132 CCL.sub.133 W.sub.134 GZ.sub.134 ACL.sub.135
GGL.sub.136 CAJ.sub.137 ATM.sub.138 TTK.sub.139 AAJ.sub.140 CAJ.sub.141
ACL.sub.142 TAK.sub.143 QR.sub.144 S.sub.144 AAJ.sub.145 TTK.sub.146
GAK.sub.147 ACL.sub.148 AAK.sub.149 QR.sub.150 S.sub.150 CAK.sub.151
AAK.sub.152 CAK.sub.153 GAK.sub.154 GCL.sub.155 X.sub.156 TY.sub.156
X.sub.157 TY.sub.157 AAJ.sub.158 AAK.sub.159 TAK.sub.160 GGL.sub.161
X.sub.162 TY.sub.162 X.sub.163 TY.sub.163 TAK.sub.164 TGK.sub.165
TTK.sub.166 W.sub.167 GZ.sub.167 AAJ.sub.168 GAK.sub.169 ATGGAK.sub.171
AAJ.sub.172 GTL.sub.173 GAJ.sub.174 ACL.sub.175 TTK.sub.176 X.sub.177
TY.sub.177 W.sub.178 GZ.sub.178 ATM.sub.179 GTL.sub.180 CAJ.sub.181
TGK.sub.182 W.sub.183 GZ.sub.183 QR.sub.184 S.sub.184 GTL.sub.185
GAJ.sub.186 GGL.sub.187 QR.sub.188 S.sub.188 TGK.sub.189 GGL.sub.190
TTK.sub.191 TAGCTGCCCGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCC-3' wherein
A is deoxyadenyl,
G is deoxyguanyl,
C is deoxycytosyl,
T is thymidyl,
J is A or G;
K is T or C;
L is A,T,C or G;
M is A, C or T;
X is T or C, if the succeeding Y is A or G, and C if the succeeding Y is C
or T;
Y is A, G, C or T, if the preceeding X is C, and A or G if the preceding X
is T;
W is C or A, if the succeeding Z is G or A, and C if the succeeding Z is C
or T;
Z is A, G, C or T, if the preceding W is C, and A or G if the preceding W
is A;
QR is TC, if the succeeding S is A, G, C or T, and AG if the succeeding S
is T or C;
S is A, G, C or T, if the preceding QR is TC, and T or C is the preceding
QR is AG and subscript numerals refer to the amino acid position in human
growth hormone, for which the nucleotide sequence corresponds, according
to the genetic code, the amino acid positions being numbered from the
amino end.
7. The recombinant DNA transfer vector of claim 6 wherein
J is A in amino acid positions: 32, 33, 39, 66, 68, 70, 119, 122 and 129,
J is G in amino acid positions: 29, 30, 38, 40, 41, 46, 49, 56, 65, 69, 74,
84, 88, 91, 115, 118, 137, 140, 141, 145, 158, 168, 172, 174, 181 and 186;
K is T in amino acid positions: 25, 31, 35, 42, 53, 111, 153 and 189;
K is C in amino acid positions: 26, 28, 44, 47, 54, 63, 72, 92, 97, 99,
100, 103, 107, 109, 112, 116, 130, 139, 143, 146, 147, 149, 151, 152, 154,
159, 160, 164, 165, 166, 169, 171, 176, 182 and 191;
L is A in amino acid positions: 37, 60, 67, 148, 155 and 175;
L is T in amino acid position: 135;
L is G in amino acid positions: 59, 90, 102, 123, 126, 136, 161, 180 and
185;
L is C in amino acid positions: 24, 27, 34, 48, 50, 61, 89, 96, 98, 104,
105, 110, 120, 131, 133, 142, 173, 187 and 190;
M is T in amino acid position: 58;
M is C in amino acid positions: 36, 78, 83, 121, 138, and 179;
X is C;
Y is A in amino acid positions: 73, 114, 117 and 156;
Y is G in amino acid positions: 45, 75, 80, 81, 87, 101, 124, 128, 162 and
177;
Y is C in amino acid positions: 52, 76, 82, 93, 113, 157 and 163;
W is A in amino acid positions: 64, 94, 127 and 167;
W is C in amino acid positions: 77, 134, 178 and 183;
Z is G in amino acid positions: 64, 94, 127, 134 and 167;
Z is C in amino acid positions: 77, 178 and 183;
QR is AG in amino acid positions: 95, 108, 132, 144 and 188;
QR is TC in amino acid positions: 43, 51, 55, 57, 62, 71, 79, 85, 106, 150
and 184;
S is A in amino acid positions: 43, 55 and 150;
S is T in amino acid positions: 57, 95, 106 and 184;
S is G in amino acid position: 85, and
S is C in amino acid positions: 51, 62, 71, 79, 108, 132, 144 and 188.
8. A transfer vector according to claim 7 comprising in addition the
nucleotide sequence, 5'-TTK.sub.1 CCL.sub.2 ACL.sub.3 ATM.sub.4 CCL.sub.5
X.sub.6 TY.sub.6 QR.sub.7 S.sub.7 W.sub.8 GZ.sub.8 X.sub.9 TY.sub.9
TTK.sub.10 GAK.sub.11 AAK.sub.12 GCL.sub.13 ATGX.sub.15 TY.sub.15 W.sub.16
GZ.sub.16 GCL.sub.17 CAK.sub.18 W.sub.19 GZ.sub.19 X.sub.20 TY.sub.20
CAK.sub.21 CAJ.sub.22 X.sub.23 TY.sub.23 -3' and wherein Y.sub.23 is
followed in sequence by GCL.sub.24 in the sequence of claim 6. |
|
 |
|
 |
Claims |
|
|
|
Description |
|
|
BACKGROUND OF THE INVENTION
Proteins and peptides are synthesized in almost endless variety by living
organisms. Many have proven to have medical, agricultural or industrial
utility. Some proteins are enzymes, useful as specific catalysts for
complex chemical reactions. Others function as hormones, which act to
affect the growth or development of an organism or to affect the function
of specific tissues in medically significant ways. Specific binding
proteins may have commercial significance for the isolation and
purification of trace substances and for the removal of contaminating
substances. Both proteins and peptides are composed of linear chains of
amino acids, the latter term being applied to short, single-chain
sequences, the former referring to long-chain and multichain substances.
The principles of the present invention apply equally to both proteins and
peptides.
Proteins and peptides are generally high molecular weight substances, each
having a specific sequence of amino acids. Except for the smaller
peptides, chemical synthesis of peptides and proteins is frequently
impractical, costly and time consuming, if not impossible. In the majority
of instances, in order to make practical use of a desired protein, it must
first be isolated from the organism which makes it. Frequently, the
desired protein is present only in minuscule amounts. Often, the source
organism cannot be obtained in quantities sufficient to provide an
adequate amount of the desired protein. Consequently, many potential
agricultural, industrial and medical applications for specific proteins
are known, but remain undeveloped simply because an adequate supply of the
desired protein or peptide does not exist.
Recently developed techniques have made it possible to employ
microorganisms, capable of rapid and abundant growth, for the synthesis of
commercially useful proteins and peptides, regardless of their source in
nature. These techniques make it possible to genetically endow a suitable
microorganism with the ability to synthesize a protein or peptide normally
made by another organism. The technique makes use of a fundamental
relationship which exists in all living organisms between the genetic
material, usually DNA, and the proteins synthesized by the organism. This
relationship is such that the amino acid sequence of the protein is
reflected in the nucleotide sequence of the DNA. There are one or more
trinucleotide sequence groups specifically related to each of the twenty
amino acids most commonly occuring in proteins. The specific relationship
between each given trinucleotide sequence and its corresponding amino acid
constitutes the genetic code. The genetic code is believed to be the same
or similar for all living organisms. As a consequence, the amino acid
sequence of every protein or peptide is reflected by a corresponding
nucleotide sequence, according to a well understood relationship.
Furthermore, this sequence of nucleotides can, in principle, be translated
by any living organism.
TABLE 1
______________________________________
Genetic Code
______________________________________
Phenylalanine(Phe)
TTK Histidine(HIS) CAK
Leucine(Leu)
XTY Glutamine(Gln) CAJ
Isoleucine(Ile)
ATM Asparagine(Asn) AAK
Methionine(Met)
ATG Lysine(Lys) AAJ
Valine(Val) GTL Aspartic acid(AsP)
GAK
Serine(Ser) QRS Glutamic acid(Glu)
GAJ
Proline(Pro)
CCL Cysteine(Cys) TGK
Threonine(Thr)
ACL Tryptophan(Tyr) TGG
Alanine(Ala)
GCL Arginine(Arg) WGZ
Tyrosine(Tyr)
TAK Glycine(Gly) GGL
Termination signal
TAJ
Termination signal
TGA
______________________________________
Key: Each 3letter triplet represents a trinucleotide of DNA having a 5'
end on the left and a 3' end on the right. The letters stand for the
purine or pyrimidine bases forming the nucleotide sequence.
A = adenine
G = guanine?
C = cytosine
J = A or G
K = T or C
L = A, T, C or G
M = A, C or T
T = thymine
X = T or C if Y is A or G
X = C if Y is C or T
Y = A, G, C or T if X is C
Y = A or G if X is T
W = C or A if Z is C or T
W = C if Z is C or T
Z = A, G, C or T if W is G
Z = A or G if W is A
QR = TC if S is A, G, C or T
QR = AG if S is T or C
S = A, G, C or T if QR is TC
S = T or C if QR is AG
The trinucleotides of Table 1, termed codons, are presented as DNA
trinucleotides, as they exist in the genetic material of a living
organism. Expression of these codons in protein synthesis requires that
intermediate formation of messenger RNA (mRNA), as described more fully,
infra. The mRNA codons have the same sequences as the DNA codons of Table
1, except that uracil is found in place of thymine. Complementary
trinucleotide DNA sequences having opposite strand polarity are
functionally equivalent to the condons of Table 1, as is understood in the
art. An important and well known feature of the genetic code is its
redundancy, whereby, for most of the amino acids used to make proteins,
more than one coding nucleotide triplet may be employed. Therefore, a
number of different nucleotide sequences may code for a given amino acid
sequence. Such nucleotide sequences are considered functionally equivalent
since they can result in the production of the same amino acid sequence in
all organisms, although certain strains may translate some sequences more
efficiently than they do others. Occasionally, a methylated variant of a
purine or pyrimidine may be found in a given nucleotide sequence. Such
methylations do not affect the coding relationship in any way.
In its basic outline, a method of endowing a microorganism with the ability
to synthesize a new protein involves three general steps: (1) isolation
and purification of the specific gene or nucleotide sequence containing
the genetically coded information for the amino acid sequence of the
desired protein, (2) recombination of the isolated nucleotide sequence
with an appropriate transfer vector, typically the DNA of a bacteriophage
or plasmid, and (3) transfer of the vector to the appropriate
microorganism and selection of a strain of the recipient microorganism
containing the desired genetic information.
A fundamental difficulty encountered in attempts to exploit commercially
the above-described general process lies in the first step, the isolation
and purification of the desired specific genetic information. DNA exists
in all living cells in the form of extremely high molecular weight chains
of nucleotides. A cell may contain more than 10,000 structural genes,
coding for the amino acid sequences of over 10,000 specific proteins, each
gene having a sequence many hundreds of nucleotides in length. For the
most part, four different nucleotide bases make up all the existing
sequences. These are adenine (A), guanine (G), cytosine (C), and thymine
(T). The long sequences comprising the structural genes of specific
proteins are consequently very similar in overall chemical composition and
physical properties. The separation of one such sequence from the plethora
of other sequences present in isolated DNA cannot ordinarily be
accomplished by conventional physical and chemical preparative methods.
Two general methods have been used in the prior art to accomplish step (1)
in the above-described general procedure. The first method is sometimes
referred to as the shotgun technique. The DNA of an organism is fragmented
into segments generally longer than the desired nucleotide sequence. Step
(1) of the above-described process is essentially by-passed. The DNA
fragments are immediately recombined with the desired vector, without
prior purification of specific sequences. Optionally, a crude
fractionation step may be interposed. The selection techniques of
microbial genetics are relied upon to select, from among all the
possibilities, a strain of microorganism containing the desired genetic
information. The shotgun procedure suffers from two major disadvantages.
Most importantly, the procedure can result in the transfer of hundreds of
unknown genes into recipient microorganisms, so that during the
experiment, new strains are created, having unknown genetic capabilities.
Therefore, the use of such a procedure could create a hazard for
laboratory workers and for the environment. A second disadvantage of the
shotgun method is that it is extremely inefficient for the production of
the desired strain, and is dependent upon the use of a selection technique
having sufficient resolution to compensate for the lack of fractionation
in the first step.
The second general method takes advantage of the fact that the total
genetic information in a cell is seldom, if ever, expressed at any given
time. In particular, the differentiated tissues of higher organisms may be
synthesizing only a major proportion of the proteins which the organism is
capable of making. In extreme cases, such cells may be synthesizing
predominantly one protein. In such extreme cases, it has been possible to
isolate the nucleotide sequence coding for the protein in question by
isolating the corresponding messenger RNA from the appropriate cells.
Messenger RNA functions in the process of converting the nucleotide
sequence information of DNA into the amino acid sequence structure of a
protein. In the first step of this process, termed transcription, a local
segment of DNA having a nucleotide sequence which specifies a protein to
be made, is first copied into RNA. RNA is a polynucleotide similar to DNA
except that ribose is substituted for deoxyribose and uracil is used in
place of thymine. The nucleotide bases in RNA are capable of entering into
the same kind of base pairing relationships that are known to exist
between the complementary strands of DNA. A and U (T) are complementary,
and G and C are complementary. The RNA transcript of a DNA nucleotide
sequence will be complementary to the copied sequence. Such RNA is termed
messenger RNA (mRNA) because of its status as intermediary between the
genetic apparatus of the cell and its protein synthesizing apparatus.
Generally, the only mRNA sequences present in the cell at any given time
are those which correspond to proteins being actively synthesized at that
time. Therefore, a differentiated cell whose function is devoted primarily
to the synthesis of a single protein will contain primarily the RNA
species corresponding to that protein. In those instances where it is
feasible, the isolation and purification of the appropriate nucleotide
sequence coding for a given protein can be accomplished by taking
advantage of the specialized synthesis of such protein in differentiated
cells.
A major disadvantage of the foregoing procedure is that it is applicable
only in the relatively rare instances where cells can be found engaged in
synthesizing primarily a single protein. The majority of proteins of
commercial interest are not synthesized in such a specialized way. The
desired proteins may be one of a hundred or so different proteins being
produced by the cells of a tissue or organism at a given time.
Nevertheless, the mRNA isolation technique is potentially useful since the
set of RNA species present in the cell usually represents only a fraction
of the total sequences existing in the DNA, and thus provides an initial
purification. In order to take advantage of such purification, however, a
method is needed whereby sequences present in low frequencies, such as a
few percent, can be isolated in high purity.
The present invention provides a process whereby nucleotide sequences can
be isolated and purified even when present at a frequency as low as 2% of
a heterogeneous population of mRNA sequences. Furthermore, the method may
be combined with known methods of fractionating mRNA to isolate and purify
sequences present in even lower frequency in the total RNA population as
initially isolated. The method is generally applicable to mRNA species
extracted from virtually any organism and is therefore expected to provide
a powerful basic tool for the ultimate production of proteins of
commercial and research interest, in useful quantities.
Human growth hormone has medical utility in the treatment of defective
pituitary function. Animal growth hormones have commercial utility in
veterinary medicine and in agriculture, particularly in the case of
animals used as food sources, where large size and rapid maturation are
desirable attributes. Human chorionic somatomammotropin is of medical
significance because of its role in the fetal maturation process.
The process of the present invention takes advantage of certain structural
features of mRNA and DNA, and makes use of certain enzyme catalyzed
reactions. The nature of these reactions and structural details as they
are understood in the prior art are described herewith. The symbols and
abbreviations used herein are set forth in the following table:
TABLE 2
______________________________________
DNA -- deoxyribonucleic acid
A -- Adenine
RNA -- ribonucleic acid
T -- Thymine
cDNA -- complementary DNA
G -- Guanine
(enzymatically synthesized
C -- Cytosine
from an mRNA sequence)
U -- Uracil
mRNA -- messenger RNA Tris -- 2-Amino-2-
dATP -- deoxyadenosine triphosphate
hydroxyethyl-
dGTP -- deoxyguanosine triphosphate
1-1,3-propanediol
dGTP -- deoxycytidine triphosphate
EDTA -- ethylene-
HCS -- Human Chorionic
diamine tetra-
Somatomammotropin acetic acid
TCA 13 Trichloroacetic acid
ATP -- adenosine
HGH -- Human Growth triphosphate
Hormone dTTP -- thymidine
triphosphate
RGH -- Rat growth
hormone
______________________________________
In its native configuration, DNA exists in the form of paired linear
polynucleotide strands. The complementary base pairing relationships
described above exist between the paired strands such that each nucleotide
base of one strand exists opposite its complement on the other strand. The
entire sequence of one strand is mirrored by a complementary sequence on
the other strand. If the strands are separate, it is possible to
synthesize a new partner strand, starting from the appropriate precursor
monomers. The sequence of addition of the monomers starting from one end
is determined by, and complementary to, the sequence of the original
intact polynucleotide strand, which thus serves as a template for the
synthesis of its complementary partner. The synthesis of mRNA
corresponding to a specific nucleotide sequence of DNA is understood to
follow the same basic principle. Therefore a specific mRNA molecule will
have a sequence complementary to one strand of DNA and identical to the
sequence of the opposite DNA strand, in the region transcribed. Enzymic
mechanisms exist within living cells which permit the selective
transcription of a particular DNA segment containing the nucleotide
sequence for a particular protein. Consequently, isolating the mRNA which
contains the nucleotide sequence coding for the amino acid sequence of a
particular protein is equivalent to the isolation of the same sequence, or
gene, from the DNA itself. If the mRNA is retranscribed to form DNA
complementary thereto (cDNA), the exact DNA sequence is thereby
reconstituted and can, by appropriate techniques, be inserted into the
genetic material of another organism. The two complementary versions of a
given sequence are therefore inter-convertible, and functionally
equivalent to each other.
The nucleotide subunits of DNA and RNA are linked together by
phosphodiester bonds between the 5' position of one nucleotide sugar and
the 3' position of its next neighbor. Reiteration of such linkages
produces a linear polynucleotide which has polarity in the sense that one
end can be distinguished from the other. The 3' end may have a free
3'-hydroxyl, or the hydroxyl may be substituted with a phosphate or a more
complex structure. The same is true of the 5' end. In eucaryotic
organisms, i.e., those having a defined nucleus and mitotic apparatus, the
synthesis of functional mRNA usually includes the addition of polyadenylic
acid to the 3' end of the mRNA. Messenger RNA can therefore be separated
from other classes of RNA isolated from an eucaryotic organism by column
chromatography on cellulose to which is attached polythymidylic acid. See
Aviv, H., and Leder, P., Proc.Nat. Acad.Sci. USA 69, 1408 (1972). Other
chromatographic methods, exploiting the base-pairing affinity of poly A
for chromatographic packing materials containing oligo dT, poly U, or
combinations of poly T and poly U, for example, poly U-Sepharose, are
likewise suitable.
Reverse transcriptase catalyzes the synthesis of DNA complementary to an
RNA template strand in the presence of the RNA template, a primer which
may be any complementary oligo or polynucleotide having a 3'-hydroxyl, and
the four deoxynucleoside triphosphates, dATP, dGTP, dCTP, and dTTP. The
reaction is initiated by the non-covalent association of the
oligodeoxynucleotide primer near the 3' end of mRNA followed by stepwise
addition of the appropriate deoxynucleotides, as determined by
base-pairing relationships with the mRNA nucleotide sequence, to the 3'
end of the growing chain. The product molecule may be described as a
hairpin structure in which the original RNA is paired by hydrogen bonding
with a complementary strand of DNA partly folded back upon itself at one
end. The DNA and RNA strands are not covalently joined to each other.
Reverse transcriptase is also capable of catalyzing a similar reaction
using a single-stranded DNA template, in which case the resulting product
is a double-stranded DNA hairpin having a loop of single-stranded DNA
joining one set of ends. See Aviv, H. and Leder, P., Proc.Natl.Acad.Sci.
USA 69, 1408 (1972) and Efstratiadis, A., Kafatos, F. C., Maxam, A. M.,
and Maniatis, T., Cell 7, 279 (1976).
Restriction endonucleases are enzymes capable of hydrolyzing phosphodiester
bonds in DNA, thereby creating a break in the continuity of the DNA
strand. If the DNA is in the form of a closed loop, the loop is converted
to a linear structure. The principal feature of a restriction enzyme is
that its hydrolytic action is exerted only at a point where a specific
nucleotide sequence occurs. Such a sequence is termed the restriction site
for the restriction endonuclease. Restriction endonucleases from a variety
of sources have been isolated and characterized in terms of the nucleotide
sequence of their restriction sites. When acting on double-stranded DNA,
some restriction endonucleases hydrolyze the phosphodiester bonds on both
strands at the same point, producing blunt ends. Others catalyze
hydrolysis of bonds separated by a few nucleotides from each other,
producing free single-stranded regions at each end of the cleaved
molecule. Such single-stranded ends are self-complementary, hence
cohesive, and may be used to rejoin the hydrolyzed DNA. Since any DNA
susceptible to cleavage by such an enzyme must contain the same
recognition site, the same cohesive ends will be produced, so that it is
possible to join heterogeneous sequences of DNA which have been treated
with restriction endonuclease to other sequences similarly treated. See
Roberts, R. J., Crit.Rev.Biochem. 4, 123 (1976).
It has been observed that restriction sites for a given enzyme are
relatively rare and are nonuniformly distributed. Whether a specific
restriction site exists within a given segment is a matter which must be
empirically determined. However, there is a large and growing number of
restriction endonucleases, isolated from a variety of sources with varied
site specificity, so that there is a reasonable probability that a given
segment of a thousand nucleotides will contain one or more restriction
sites.
For general background see Watson, J. D., The Molecular Biology of the
Gene, 3d Ed., Benjamin, Menlo Park, Calif., (1976); Davidson, J. N., The
Biochemistry of the Nucleic Acids, 8th Ed., Revised by Adams, R. L. P.,
Burdon, R. H., Campbell, A. M. and Smellie, R. M. S., Academic Press, New
York, (1976); and Hayes, W., "The Genetics of Bacteria and Their Viruses",
Studies in Basic Genetics and Molecular Biology, 2d Ed., Blackwell
Scientific Pub., Oxford (1968).
SUMMARY OF INVENTION
A novel purification procedure of cDNA of desired nucleotide sequence
complementary to an individual mRNA species is disclosed. The method
employs restriction endonuclease cleavage of cDNA transcribed from a
complex mixture of mRNA. The method does not require any extensive
purification of RNA but instead makes use of transcription of RNA into
cDNA, the sequence specific fragmentation of this cDNA with one or two
restriction endonucleases, and the fractionation of the cDNA restriction
fragments on the basis of their length. The use of restriction
endonucleases eliminates size heterogeneity and produces homogeneous
length DNA fragments from any cDNA species which contains at least two
restriction sites. From the initially heterogeneous population of cDNA
transcripts, uniform size fragments of desired sequence are produced. The
fragments may be several hundred nucleotides in length and may in some
instances include the entire structural gene for the desired protein. The
length of the fragments depends on the number of nucleotides separating
the restriction sites and will usually be different for different regions
of DNA. Fractionation by length enables purification of a homogeneous
population of fragments having the desired sequence. The fragments will be
homogeneous in size and highly pure in terms of nucleotide sequence.
Current separation and analysis methods enable the isolation of such
fragments from a corresponding mRNA species representing at least 2% of
the mass of the RNA transcribed. The use of prior art RNA fractionation
methods to prepurify the mRNA before transcription will result in lowering
the actual lower limit of detection to less than 2% of the total mRNA
isolated from the organism.
Specific sequences purified by the procedure outlined above may be further
purified by a second specific cleavage with a restriction endonuclease
capable of cleaving the desired sequence at an internal site. This
cleavage results in formation of two sub-fragments of the desired
sequence, separable on the basis of their lengths. The sub-fragments are
separated from uncleaved and specifically cleaved contaminating sequences
having substantially the same original size. The method is founded upon
the rarity and randomness of placement of restriction endonuclease
recognition sites, which results in an extremely low probability that a
contaminant having the same original length will be cleaved by the same
enzyme to yield fragments having the same length as those yielded by the
desired sequence. After separation from the contaminants, the
sub-fragments of the desired sequence may be rejoined using techniques
known in the art to reconstitute the original sequence. The two
sub-fragments must be prevented from joining together in the reverse order
of their original sequence. A method is disclosed whereby the
sub-fragments can only join to each other in the proper order.
Variations of the above-recited methods may be used in combination with
appropriate labelling techniques to obtain accurate, quantitative
measurements of the purity of the isolated sequences. The combined
techniques have been applied to produce a known nucleotide sequence with
greater than 99% purity.
The cDNA isolated and purified by the described methods may be recombined
with a suitable transfer vector and transferred to a suitable host
microorganism. Novel plasmids have been produced, containing the
nucleotide sequences coding for rat growth hormone and the major portions
of human chorionic somatomammotropin and human growth hormone,
respectively. Novel microorganisms have been produced having as part of
their genetic makeup the genes coding for RGH, the major portion of HCS
and the major portion of HGH, respectively. The disclosed techniques may
be used for the isolation and purification of growth hormones from other
animal species and for the construction of novel transfer vectors and
microorganisms containing these genes.
DETAILED DESCRIPTION OF INVENTION
The present invention employs as starting material polyadenylated, crude or
partially purified messenger RNA, which may be heterogeneous in sequence
and in molecular size. The selectivity of the RNA isolation procedure is
enhanced by any method which results in an enrichment of the desired mRNA
in the heterodisperse population of mRNA isolated. Any such
prepurification method may be employed in conjunction with the method of
the present invention, provided the method does not introduce
endonucleolytic cleavage of the mRNA. An important initial consideration
is the selection of an appropriate source tissue for the desired mRNA.
Often, this choice will be dictated by the fact that the protein
ultimately to be produced is only made by a certain specialized tissue of
a differentiated organism. Such is the case, for example, with the peptide
hormones, such as growth hormone or HCS. In other cases, it will be found
that a variety of cell types or microbial species can serve as a source of
the desired mRNA. In those cases, some preliminary experimentation will be
necessary in order to determine the optimal source. Frequently, it will be
found that the proportion of desired mRNA can be increased by taking
advantage of cellular responses to environmental stimuli. For example,
treatment with a hormone may cause increased production of the desired
mRNA. Other techniques include growth at a particular temperature and
exposure to a specific nutrient or other chemical substance.
Prepurification to enrich for desired mRNA sequences may also be carried
out using conventional methods for fractionating RNA, after its isolation
from the cell. Any technique which does not result in degradation of the
RNA may be employed. The techniques of preparative sedimentation in a
sucrose gradient and gel electrophoresis are especially suitable.
The mRNA must be isolated from the source cells under conditions which
preclude degradation of the mRNA. The action of RNase enzymes is
particularly to be avoided because these enzymes are capable of hydrolytic
cleavage of the RNA nucleotide sequence. The hydrolysis of one bond in the
sequence results in disruption of that sequence and loss of the RNA
fragment containing the original 5' end of the sequence. A suitable method
for inhibiting RNase during extraction from cells is disclosed in U.S.
application Ser. No. 805,023, now abandoned incorporated herein by
reference, assigned to the same assignee as the instant application. The
method involves the use of 4 M guanidinium thiocyanate and 1 M
mercaptoethanol during the cell disruption step. In addition, a low
temperature and a pH near 5.0 are helpful in further reducing RNase
degradation of the isolated RNA.
Prior to application of the method of the present invention, mRNA must be
prepared essentially free of contaminating protein, DNA, polysaccharides
and lipids. Standard methods are well known in the art for accomplishing
such purification. RNA thus isolated contains non-messenger as well as
messenger RNA. A convenient method for separating the mRNA of eucaryotes
is chromatography on columns of oligo-dT cellulose, or other
oligonucleotide-substituted column material such a poly U-Sepharose,
taking advantage of the hydrogen bonding specificity conferred by the
presence of polyadenylic acid on the 3' end of eucaryotic mRNA.
The initial step in the process of the present invention is the formation
of DNA complementary to the isolated heterogeneous sequences of mRNA. The
enzyme of choice for this reaction is reverse transcriptase, although in
principle any enzyme capable of forming a faithful complementary DNA copy
of the mRNA template could be used. The reaction may be carried out under
conditions described in the prior art, using mRNA as a template and a
mixture of the four deoxynucleoside triphosphates dATP, dGTP, dCTP and
dTTP, as precursors for the DNA strand. It is convenient to provide that
one of the deoxynucleoside triphosphates be labeled with a radioisotope,
for example .sup.32 P in the alpha position, in order to monitor the
course of the reaction, to provide a tag for recovering the product after
separation procedures such as chromatography and electrophoresis, and for
the purpose of making quantitative estimates of recovery. See
Efstratiadis, A., et al., supra.
The cDNA transcripts produced by the reverse transcriptase reaction are
somewhat heterogeneous with respect to sequences at the 5' end and the 3'
end due to variations in the initiation and termination points of
individual transcripts, relative to the mRNA template. The variability at
the 5' end is thought to be due to the fact that the oligo-dT primer used
to initiate synthesis is capable of binding at a variety of loci along the
polyadenylated region of the mRNA. Synthesis of the cDNA transcript begins
at an indeterminate point in the poly-A region, and a variable length of
poly-A region is transcribed depending on the initial binding site of the
oligo-dT primer. It is possible to avoid this indeterminacy by the use of
a primer containing, in addition to an oligo-dT tract, one or two
nucleotides of the RNA sequence itself, thereby producing a primer which
will have a preferred and defined binding site for initiating the
transcription reaction.
The indeterminacy at the 3'-end of the cDNA transcript is due to a variety
of factors affecting the reverse transcriptase reaction, and to the
possibility of partial degradation of the RNA template. The isolation of
specific cDNA transcripts of maximal length is greatly facilitated if
conditions for the reverse transcriptase reaction are chosen which not
only favor full length synthesis but also repress the synthesis of small
DNA chains. Preferred reaction conditions for avian myeloblastosis virus
reverse transcriptase are given in the examples section. The specific
parameters which may be varied to provide maximal production of long-chain
DNA transcripts of high fidelity are reaction temperature, salt
concentration, amount of enzyme, concentration of primer relative to
template, and reaction time.
The conditions of temperature and salt concentration are chosen so as to
optimize specific base-pairing between the oligo-dT primer and the
polyadenylated portion of the RNA template. Under properly chosen
conditions, the primer will be able to bind at the polyadenylated region
of the RNA template, but non-specific initiation due to primer binding at
other locations on the template, such as short, A-rich sequences, will be
substantially prevented. The effects of temperature and salt are
interdependent. Higher temperatures and lower salt concentrations decrease
the stability of specific base-pairing interactions. The reaction time is
kept as short as possible, in order to prevent non-specific initiations
and to minimize the opportunity for degradation. Reaction times are
interrelated with temperature, lower temperatures requiring longer
reaction times. At 42.degree. C., reactions ranging from 1 min. to 10
minutes are suitable. The primer should be present in 50 to 500-fold molar
excess over the RNA template and the enzyme should be present in similar
molar excess over the RNA template. The use of excess enzyme and primer
enhances initiation and cDNA chain growth so that long-chain cDNA
transcripts are produced efficiently within the confines of the sort
incubation times.
In many cases, it will be possible to carry out the remainder of the
purification process of the present invention using single-stranded cDNA
sequences transcribed from mRNA. However, as discussed below, there may be
instances in which the desired restriction enzyme is one which acts only
on double-stranded DNA. In these cases, the cDNA prepared as described
above may be used as a template for the synthesis of double-stranded DNA,
using a DNA polymerase such as reverse transcriptase and a nuclease
capable of hydrolyzing single-stranded DNA. Methods for preparing
double-stranded DNA in this manner have been described in the prior art.
See, for example, Ullrich, A., Shine, J., Chirgwin, J., Pictet, R.,
Tischer, E., Rutter, W. J. and Goodman, H. M., Science 196, 1313 (1977).
Heterogeneous cDNA, prepared by transcription of heterogeneous mRNA
sequences, is then treated with one or two restriction endonucleases. The
choice of endonuclease to be used depends in the first instance upon a
prior determination that recognition sites for the enzyme exist in the
sequence of the cDNA to be isolated. The method depends upon the existence
of two such sites. If the sites are identical, a single enzyme will be
sufficient. The desired sequence will be cleaved at both sites,
eliminating size heterogeneity as far as the desired cDNA sequence is
concerned, and creating a population of molecules, termed fragments,
containing the desired sequence and homogeneous in length. If the
restriction sites are different, two enzymes will be required in order to
produce the desired homogeneous length fragments.
The choice of restriction enzyme(s) capable of producing an optimal length
nucleotide sequence fragment coding for all or part of the desired protein
must be made empirically. If the amino acid sequence of the desired
protein is known, it is possible to compare the nucleotide sequence of
uniform length nucleotide fragments produced by restriction endonuclease
cleavage with the amino acid sequence for which it codes, using the known
relationship of the genetic code common to all forms of life. A complete
amino acid sequence for the desired protein is not necessary, however,
since a reasonably accurate identification may be made on the basis of a
partial sequence. Where the amino acid sequence of the desired protein is
now known, the uniform length polynucleotides produced by restriction
endonuclease cleavage may be used as probes capable of identifying the
synthesis of the desired protein in an appropriate in vitro protein
synthesizing system. Alternatively, the mRNA may be purified by affinity
chromatography. Other techniques which may be suggested to those skilled
in the art will be appropriate for this purpose.
The number of restriction enzymes suitable for use depends upon whether
single-stranded or double-stranded cDNA is used. The preferred enzymes are
those capable of acting on single-stranded DNA, which is the immediate
reaction product of mRNA reverse transcription. The number of restriction
enzymes now known to be capable of acting on single-stranded DNA is
limited. The enzymes HaeIII, HhaI and Hin(f)I are presently known to be
suitable. In addition, the enzyme MboII may act on single-stranded DNA.
Where further study reveals that other restriction enzymes can act on
single-stranded DNA, such other enzymes may appropriately be included in
the list of preferred enzymes. Additional suitable enzymes include those
specified for double-stranded cDNA. Such enzymes are not preferred since
additional reactions are required in order to produce double-stranded
cDNA, providing increased opportunities for the loss of longer sequences
and for other losses due to incomplete recovery. The use of
double-stranded c | | |
