 |
Description  |
|
|
FIELD OF THE INVENTION
The invention relates to the field of recombinant DNA technology. In
particular, it relates to expression vectors for the production and
processing of proteins that are heterologous to the host cell, the
expression of which is controlled in part by a promoter and secretion
leader that are heterologous to the protein that is expressed. The
invention also concern certain modified proteins that are efficiently
expressed and processed by the host cell under the control of the
heterologous promoter and secretory leader.
BACKGROUND OF THE INVENTION
The expression of proteins heterologous to host cell has been accomplished
with varying degree of success in a variety of host cells. For example,
DNA encoding enzymes originating in the genome of one species of
prokaryote have been integrated into plasmid and expressed and secreted
from cells of a different prokaryotic species. Indeed, proteins
originating in genera as varied as Homo sapiens, Bos, OVIS, Mus, Rattus,
and others have been successfully expressed in, for example, E. coli,
Saccharomyes, Streptomyces, Bacillus, and other recombinant host cells.
Notwithstanding the notable successes in, for example, the expression and
secretion of insulin from E. coli as a fusion protein, the successful
production and processing of proteins in association with secretion
leaders is by no means a routinely achievable event. Numerous factors are
entailed in the successful expression and secretion of a polypeptide in a
recombinant host. The host may process certain codons encoding particular
amino acids with greater fidelity than other codons encoding the same
amino acid. The mRNA transcript may have the ability to form secondary
structures with itself and such secondary structures may lead to decreased
translation. The mRNA transcript may also form secondary structures with
control sequences for the translation of the transcript such as the
ribosome binding site, thereby interfering with the binding of the
transcript to the ribosome and the efficient translation thereof.
After translation of the mRNA transcript has been successfully
accomplished, the proper folding of the translated protein, as well as
post-translational processing and secretion must also occur in order to
obtain a biologically active recombinantly produced protein. Secretion, a
proper folding of a protein and processing, which may be regarded as the
cleavage of the mature protein from a secretion leader may be events that
are separable or inseparable.
Pseudomonas exotoxin (PE) A is a powerful bacterial toxin that acts as an
ADP-ribosyl transferase and inhibits protein synthesis in eukaryotic cells
by catalyzing the transfer of the ADP ribosyl moiety from oxidized NAD
onto elongation factor-2 (EF-2). The nucleotide sequence of PE and its
cloning and expression in E. coli has been disclosed by Gray et al., Proc.
Natl. Acad. Sci. USA 81: 2645-2649 (1984). Most importantly, Gray et al.
report that the material so expressed is enzymatically active but is
neither processed nor secreted. They suggest that all the components
required for secretion of PE toxin from E. coli are not present in that
host. Gray et al. also point out that PE and diphtheria toxin (DT) share
certain characteristics including size, secretion as a single polypeptide
chain having disulfide bridges and no free sulfhydryl groups, alteration
in covalent structure from an inactive proenzyme to an enzymatically
active state, similarity of site of enzymatic activity and maximal
production in iron deficient medium. Despite these similarities, the two
toxins are immunologically non-crossreactive, have different amino acid
composition, differ in their mode of activation, and bind to different
cell receptors. Furthermore, while intact DT binds ATP and possesses NAD
glycohydrolase activity, PE lacks these properties. Lastly, computer
analysis and DNA hybridization studies carried out by Gray et al. indicate
no regions of significant homology between these proteins.
Mozola et al., J. Bacteriol., 159: 2, 683-687 (1984) report the cloning and
expression in E. coli and Pseudomonas of fragments of the Pseudomonas
exotoxin A DNA sequence derived from the chromosomal DNA of P. aeruginosa
strain PA103. These cloned and expressed partial sequences, while having
at least partial immunological identity with Pseudomonas exotoxin A by
Western blot, were from the carboxyl terminal regions of the gene encoding
the toxin. Further, supporting this conclusion by Mazola et al. that the
NH.sub.2 -terminus of the gene was not present, was the observation that
the protein was not secreted. The known published literature therefore
indicates that secretion of Pseudomonas exotoxin A as a cloned product in
both Pseudomonas and in other hosts is unprecedented.
Immunoconjugates of Pseudomonas exotoxin are known and methods for the
making thereof are disclosed in U.S. Pat. No. 4,545,985.
It would be advantageous to produce Pseudomonas exotoxin A and other
proteins in processed form in a convenient host. The production of
processed proteins in which a leader sequence is removed from the mature
protein would confer several advantages. First, such processed proteins
would lack amino acids unnecessary in the mature form for the biological
activity of the protein. If the processed protein is obtained and
ultimately used parenterally in a patient, the absence of leader sequence
amino acids would be expected to make the mature protein less immunogenic.
In addition, processing of the leader sequence and production of the
mature protein clearly accomplishes, in the recombinant host, a processing
step that would otherwise be carried out by other chemical or enzymatic
means. Processing of the leader sequence by the recombinant host and
proper secretion may also, advantageously assist in the proper folding of
the expressed protein product thereby to achieve biological activity
without further in vitro processing steps.
Furthermore, processing by E. coli as the recombinant host to form a mature
proteion, eliminates the necessity of placing an NH.sub.2 -terminal
methionine at the NH.sub.2 -terminus of the mature protein since the start
codon ATG is found at the signal or leader sequence NH.sub.2 -terminus.
Such NH.sub.2 -terminal methionine residues may be immunogenic when formed
as part of a mature protein and may be chemotactic.
In addition, such in vivo processing of the precursor protein by the
recombinant host is involved in extracellular secretion of the processed
protein. In most Gram-negative hosts, such secretion might be expected to
be periplasmic. Suh periplasmic extracellular secretion can be expected to
lead to savings in the processing to remove extraneous intracellular
proteins produced by the recombinant host. Surprisingly, it has been found
that at least with respect to Pseudomonas exotoxin A secretion in E. coli,
is extramural, i.e., passes through the cell wall and accumulates in the
growth medium.
BRIEF DESCRIPTION OF THE INVENTION
In one respect, the invention concerns an expression vector suitable for
expression of proteins in Gram-negative hosts such as E. coli comprising a
DNA sequence encoding a diphtheria toxin secretion leader having a
translation initiation signal compatible with the Gram-negative host in
reading frame with a DNA sequence encoding a protein heterologous to the
DT leader, said protein having an NH.sub.2 -terminal consensus sequence
comprising gly-B, C, D, E, F, and G. B is a mildly hydrophobic amino acid
C, D and G are negatively charged amino acids in aqueous solution at pH 7,
and at least one of E and F is a hydrophobic amino acid.
In another respect the invention relates to DNA sequences encoding mature
proteins heterologous to the DT leader that have been altered in the
NH.sub.2 -terminal region thereof to be compatible with the DT leader
whereby the DT leader is cleaved from the mature protein.
In yet another aspect the invention relates to DNA sequences encoding
mature protein heterologous to the DT leader comprising an NH.sub.2
-terminal concensus sequence of about 7 amino acids compatible with the DT
leader.
In still another aspect, the invention relates to DNA sequences encoding an
amino acid consensus sequence of 7 amino acids provided that said
consensus sequence is the same as the NH.sub.2 -terminal amino acids of
DTA.
In a further embodiment, the invention relates to a mature protein having
an NH.sub.2 -terminal region compatible with the DT leader sequence
provided that the mature protein is not diphtheria toxin or an
enzymatically active or inactive form of diphtheria toxin.
In yet a further embodiment, the invention relates to a mature protein
having an N-terminus that has been altered to be compatible with the DT
leader wherein the DT leader is cleaved from the mature protein.
In yet a further aspect, the invention relates to an amino acid consensus
sequence comprising about 7 amino acids compatible with the DT leader
provided that said consensus sequence does not form the NH.sub.2 -terminal
amino acids sequence of diphtheria toxin.
In yet a still further embodiment, the invention relates to a microbial
host cell transformed with an expression vector suitable for expression of
proteins in Gran-negative hosts such as E. coli comprising a DNA sequence
encoding a diphtheria toxin secretion leader having a translation start
signal compatible with the Gram-negative host fused in reading frame to a
DNA sequence encoding a protein heterologous to the DT leader, said mature
protein having an NH.sub.2 -terminal sequence comprising gly B, C, D, E,
F, and G, wherein B is a mildly hydrophobic amino acid, C, D and G are
negatively charged amino acids in aqueous solution at pH 7 and at least
one of E and F is a hydrophobic amino acid.
In a preferred embodiment, the mature protein is a modified Pseudomonas
exotoxin A having in addition to the amino acid sequence of Pseudomonas
exotoxin A, an NH.sub.2 -terminal glycine.
In another aspect of the preferred embodiment the Pseudomonas exotoxin A
having an NH.sub.2 -terminal glycine is secreted from E. coli in an
enzymatically active soluble form. More preferred is the soluble secreted
modified Pseudomonas exotoxin A which is secreted through the cell wall of
E. coli.
In another preferred embodiment, the mature protein is human CSF having in
addition to the amino acid sequence of mature CSF-1, two additional
NH.sub.2 -terminal amino acids glycine and alanine.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention will be better understood in conjunction with the following
drawings.
FIG. 1 is a schematic map of the Pseudomonas exotoxin A strutural gene in
which the first nucleotide of the PstI site is designated as base pair 1
and the last nucleotide of the EcoRI site is designated 2760. FIG. 1 also
shows a number of fragments used in the construction of Pseudomonas
exotoxin A according to the invention. Each of these fragments is
designated by the nucleotide number of its ends in relationship to the
PstI site. The location of various restriction endonuclease sites is also
shown for some of the fragments.
FIG. 2 is a schematic illustration of the cloning of Pseudomonas exotoxin A
fragment and the creation of a glycine codon and SmaI restriction site
therein by site specific mutagenesis.
FIG. 3 is a schematic map of the diphtheria toxin structural gene. The
first nucleotide of the MspI site 5' prior to the DTA leader is designated
as base pair 1. FIG. 3 also shows a number of DT fragments used in the
construction of the vector according to the invention. Each of these
fragments is designated by the nucleotide number of its ends in
relationship to the first designated MspI site.
FIG. 4 is a schematic illustration of the modifications carried out to the
DT leader sequence. In FIG. 4A site specific mutagenesis was used to
replace the GTG translation start codon with ATG and to insert a HindIII
site immediately 5' to the ATG codon. In FIG. 4B site specific mutagenesis
was used to insert a SacI site for blunt end ligations to genes encoding
proteins to be expressed under control of the DT leader, and to insert a
BamHI site 3' to the SacI site for further cloning of the DT leader. In
FIG. 4C the mutagenized DT leader is cloned into pBR322 generating plasmid
pBRDTL10. The DT leader is fused to the modified Pseudomonas exotoxin A by
blunt ending the SacI site at the carboxyl end of the DT leader within
pBRDTL10 followed by digestion with EcoRI, and ligation to EcoRI/SmaI
digested M13SMAglyPTBM2 to form the recombinant phage M13DTLPTBM9 which
therefore contains the modified DT leader and NH.sub.2 -terminal
gly-modified mature PE in operable linkage with one another.
FIG. 5 is a schematic illustration of modification of the Pseudomonas
exotoxin A gene to make it more convenient for cloning into a suitable
expression vector.
FIG. 6 is a schematic illustration of the construction of an expression
vector in which the modified DT leader and NH.sub.2 -terminal gly-mature
Pseudomonas exotoxin A gene are placed under control of the P.sub.L
promoter for expression of soluble recombinant Pseudomonas exotoxin A.
FIG. 7 is a schematic illustration of the construction of plasmids
DTCCSF3-3.
FIG. 8 is a gel showing the distribution of Pseudomonas toxin according to
the invention in cells and culture medium.
DETAILED DESCRIPTION OF THE INVENTION
General Methods for Carrying Out the Invention
Transformations
Depending on the host cell used, transformation is done using standard
techniques appropriate to such cells. The calcium treatment employing
calcium chloride, as described by Cohen, S. N., Proc. Natl. Acad. Sci.
(USA) (1972) 69: 2110, or the RbCl.sub.2 method described in Maniatis, et
al., Molecular Cloning: A Laboratory Manual (1982) Cold Spring Harbor
Press, p. 254 was used for procaryotes or other cells which contain
substantial cell wall barriers. Infection with Agrobacterium tumefaciens
(Shaw, C. H., et al., Gene (1983) 23: 315) is used for certain plant
cells. For mammalian cells without such cell walls, the calcium phosphate
precipitation method of Graham and van der Eb, Virology (1978) 52: 546 is
preferred. Transformations into yeast are carried out according to the
method of Van Solingen, P., et al., J. Bact. (1977) 130: 946 and Hsiao, C.
L., et al., Proc. Natl. Acad. Sci. (USA) (1979) 76: 3829.
Vector Construction
Construction of suitable vectors containing the desired coding and control
sequences employs standard ligation and restriction techniques which are
well understood in the art. Isolated plasmids, DNA sequences, or
synthesized oligonucleotides are cleaved, tailored, and religated in the
form desired.
Site specific DNA cleavage is performed by treating with the suitable
restriction enzyme (or enzymes) under conditions which are generally
understood in the art, and the particulars of which are specified by the
manufacturer of these commercially available restriction enzymes. See,
e.g., New England Biolabs, Product Catalog. In general, about 1 .mu.g of
plasmid or DNA sequence is cleaved by one unit of enzyme in about 20 .mu.l
of buffer solutions. In the examples herein, typically, an excess of
restriction enzyme is used to ensure complete digestion of the DNA
substrate. Incubation times of about one hour to two hours at about
37.degree. C. are workable, although variations can be tolerated. After
after incubation, protein is removed by extraction with phenol/chloroform,
and may be followed by ether extraction, and the nucleic acid recovered
from aqueous fractions by precipitation with ethanol followed by running
over a Sephadex G-50 spin column or Biogel P-4. If desired, size
separation of the cleaved fragments may be performed by polyacrylamide gel
or agarose gel electrophoresis using standard techniques. A general
description of size separations is found in Methods in Enzymology (1980)
65: 499-560.
Restriction cleaved fragments may be blunt ended by treating with the large
fragment of E. coli DNA Polymerase I (Klenow) in the presence of the four
deoxyribonucleotide triphosphates (dNTPs) using incubation times of about
15 to 25 minutes at 20.degree. to 25.degree. C. in 50 mM Tris pH 7.6, 50
mM NaCl, 6 mM MgCl.sub.2, 6 mM DTT and 5-10 .mu.M dNTPs. The Klenow
fragment fills in at 5' sticky ends but chews back protruding 3' single
strands, even though the four dNTPs are present. If desired, selective
repair can be performed by supplying only one of the, or selected, dNTPs
within the limitations dictated by the nature of the sticky ends. After
treatment with Klenow, the mixture is extracted with phenol/chloroform and
ethanol precipitated followed by running over a Sephadex G-50 spin column
or Biogel P-4. Treatment under appropriate conditions with Sl nuclease
results in hydrolysis of any single-stranded portion.
Ligations are performed in 15-30 .mu.l volumes under the following standard
conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 mM MgCl.sub.2, 10 mM
DTT, 33 .mu.g/ml BSA, 10 mM-50 mM NaCl, and either 40 .mu.M ATP, 0.01-0.02
(Weiss) units T4 DNA ligase at 0.degree. C. (for "sticky end" ligation) or
1 mM ATP, 0.3-0.6 (Weiss) units T4 DNA ligase at 14.degree. C. (for "blunt
end" ligation). Intermolecular "sticky end" ligations are usually
performed at 33-100 .mu.g/ml total DNA concentrations (5-100 nM total end
concentration). Intermolecular "blunt end" ligations (usually employing a
10-30 fold molar excess of linkers) are perfomed at 1 .mu.M total ends
concentration.
Synthetic oligonucleotides are prepared by the triester method of
Matteucci, et al. (J. Am. Chem. Soc. (1981) 103: 3185) or using
commercially available automated oligonucleotide synthesizers. Kinasing of
single strands prior to annealing or for labeling is achieved using an
excess, e.g., approximately 10 units of polynucleotide kinase to 0.1 nmole
substrate in the presence of 50 mM Tris, pH 7.6, 10 mM MgCl.sub.2, 5 mM
dithiothreitol, 1-2 mM ATP, 1.7 pmoles 32P-ATP (2.9 mCi/mmole), 0.1 mM
spermidine, 0.1 mM EDTA.
In vector construction employing "vector fragments", the vector fragment is
commonly treated with bacterial alkaline phosphatase (BAP) in order to
remove the 5' phosphate and prevent religation of the vector. BAP
digestions are conducted at pH 8 in approximately 150 mM Tris, in the
presence of Na.sup.+ and Mg.sup.+2 using about 1 unit of BAP per .mu.g of
vector at 37.degree. C. or 60.degree. C. for about one hour. Vector
fragments subjected to this treatment are referred to herein as "bapped".
In order to recover the nucleic acid fragments, the preparation is
extracted with phenol/chloroform and ethanol precipitated and desalted by
application to a Sephadex G-50 or Biogel P-4 spin column. Alternatively,
religation can be prevented in vectors which have been double digested by
additional restriction enzyme digestion of the unwanted fragments.
For portions of vectors which require sequence modifications, site specific
primer directed mutagenesis is preferred. This is conducted using a primer
synthetic oligonucleotide complementary to a single stranded phage DNA to
be mutagenized except for limited mismatching, representing the desired
mutation. Briefly, the synthetic oligonucleotide is used as a primer to
direct synthesis of a strand complementary to the single stranded phage
DNA, and the resulting double-stranded DNA is transfected into a
phage-supporting host bacterium. Cultures of the transformed bacterial are
plated in top agar, containing susceptible bacterial, permitting plaque
formation from single cells which harbor the phage. Sequence modification
can also be accomplished by synthesizing the desired DNA sequence de novo
from synthetic oligonucleotides as described above.
Theoretically, 50% of the new plaques will contain the phage having, as a
single strand, the mutated form; 50% will have the original sequence. The
resulting plaques are hybridized with kinased synthetic primer at a
temperature which permits hybridization of an exact match, but at which
the mismatches with the original strand are sufficient to prevent
hybridization. Plaques which hybridize with the probe are then picked,
cultured, and the DNA recovered. Details of site specific mutation
procedures are described below in specific examples.
Verification of Construction
In the constructions set forth below, correct ligations for plasmid
construction are confirmed by first transforming E. coli strain MM294
obtained from E. coli Genetic Stock Center, CGSC 6135, or other suitable
host with the ligation mixture. Successful transformants are selected by
ampicillin, tetracycline or other antibiotic resistance or using other
markers depending on the mode of plasmid construction, as is understood in
the art. Plasmids from the transformants are then prepared according to
the method of Clewell, D. B., et al., Proc. Natl. Acad. Sci. (USA) (1969)
62: 1159, optionally following chloramphenicol amplification (Clewell, D.
B., J. Bacteriol. (1972) 110: 667). The isolated DNA is analyzed by
restriction and/or sequenced by the dideoxy method of Sanger, F., et al.,
Proc. Natl. Acad. Sci. (USA) (1977) 74: 5463 as further described by
Messing, et al., Nucleic Acids Res. (1981) 9: 309, or by the method of
Maxam, et al., Methods in Enzymology (1980) 65: 499.
Hosts Exemplified
Host strains used in cloning and expression herein are as follows:
For cloning and sequencing, and for expession of construction under control
of most bacterial promoters, E. coli strain MM294 (supra), Talmadge, K.,
et al., Gene (1980) 12: 235; Messelson, M., et al., Nature (1968) 217:
1110, was used as the host or a derivative DG98. For expression under
control of the P.sub.L gene N.sup.RBS promoter, E. coli strain K12
MC10001ambda lysogen, N.sub.7 N.sub.53 cI857SusP.sub.80, ATCC 39531
(hereinafter sometimes referred to as MC1000-39513) is used.
For M13 phage recombinants, E. coli strains susceptible to phage infection,
such as E. coli K12 strain DG98 are employed. The DG98 strain has been
deposited with ATCC July 13, 1984 and has accession number 39,768.
Definitions
1. "Compatible" as used herein with respect to translation initiation
(start) signals in E. coli means an initiation signal that is recognized
by the ribosome of E. coli as the point for initiation of translation of a
transcribed messenger RNA (mRNA). Based on the work of Shine and Delgarno,
an ATG codon is preferred in E. coli. "Compatible" as used herein with
respect to a mature protein in connection with a leader sequence means
that the protein having the leader is processed by the host such that the
mature protein is specifically cleaved from the leader sequence.
2. "In reading frame" as used herein refers to the sequential arrangment of
nucleotides in sets of three that encodes the sequence of a protein
without producing nonsense codons (i.e., not coding for an amino acid) or
premature stop codons.
3. "Heterologous to DT leader" as used herein refers to DNA sequences
encoding protein or proteins other than diphtheria toxin or fragments
thereof.
4. "Consensus sequence" as used herein means a primary sequence of amino
acids defining a series of positions within the consensus sequence wherein
any amino acid in a particular position in the concensus sequence has
certain shared characteristics with any other amino acid occupying the
same position of the series.
5. By "mildly hydrophobic" is meant having a hydrophobicity correlation
coefficient of at least 0.87 as described by Kubota, J. Theor. Biol., 91:
350 (1981).
6. By "charged" is meant that the side chain of amino acid has a positive
or a negative charge at biocompatible pH of 6-8 and high coefficient of
polarity as described in Kubota, supra.
7. "Strongly hydrophobic" means having a hydrophobicity correlation
coefficient of at least 1.6 as described in Kubota, supra.
8. By "mature" with respect to proteins, is meant an amino acid sequence
encoding a protein free of cleaved or cleavable secretion leader sequences
at the NH.sub.2 -terminal sequence thereof.
9. "NH.sub.2 -terminal" as used herein with respect to proteins means the
amino terminal end of a protein with respect to the primary amino acid
sequence of the protein.
10. By "microbial host" is meant in general a prokayotic host cell,
preferably E. coli and any one of the Gram-negative microorganisms known
to exchange genetic information therewith in nature or in the laboratory.
A list of such naturally exchanging Gram-negative host cells is found in
the Guidelines for Recombinant DNA published by the United States
Government Printing Office from time to time in the Federal Register.
11. "Secreted" as used herein means that the protein or mature protein does
not remain within the cytosol of the cell and may be found in the
periplasmic space or outside of the cell wall in some instances.
12. "Enzymatically active" with respect to Pseudomonas exotoxin A means
having the ability to inhibit the function of elongation factor 2 (EF2) as
determined by covalently binding ADP ribose to EF2. The ADP-ribose-EF2 is
unable to catalyse the translocation reaction of peptidyl tRNA from the
A-site to the P-site on the ribosomes, causing the elongation cycle to
stop.
13. "Soluble" as used herein refers to a protein that remains in the
supernatant after centrifugation for 30 minutes at 100,000.times.g in
aqueous buffer under physiologically isotonic conditions such as 0.14M
sodium chloride, or sucrose at a protein concentration of as much as 10
mg/ml in the absence of detergents or denaturants.
14. "Extramurally secreted" when used in connection with secretion of
proteins by Gram-negative microorganisms means that the protein may be
found outside the cell wall of the intact microorganism and is usually
recoverable from the growth medium.
15. "Processed" as used herein with respect to a signal or leader peptide
and amino acid sequence joined thereto, means that the leader peptide is
cleaved from the amino acid sequence joined thereto by the recombinant
host.
Modes for Carrying Out The Invention
The invention generally concerns DNA sequences encoding mature proteins in
which the mature protein is compatible with, but heterologous to a leader
sequence. In the invention a DNA sequence encodes a continuous sequence of
amino acids comprising a leader sequence in reading frame with a mature
protein. The leader sequence is in general hetrologous to the mature
protein in the sense that the mature protein is usually not found in any
known host cell in nature as part of a continuous sequence of amino acids
with the leader sequence. In the present invention, this situation is
exemplified by a DNA sequence encoding a continuous amino acid sequence
comprising the diphtheria toxin leader sequence and a sequence for the
mature protein which is altered Pseudomonas exotoxin A or human CSF-1.
Neither of these mature proteins is produced in any known host with the DT
leader sequence. It has been found, for example, that by altering the DNA
sequence encoding the heterologous mature protein within the NH.sub.2
-terminal region thereof, that it is possible to create a heterologous
mature protein that is compatible with the leader sequence. In general,
such DNA sequences encoding the mature protein, conform to a preferred
sequence of amino acids that are recognized as a processing point and
yield, at a minimum, specific cleavage of the altered mature protein from
the leader sequence. Such preferred sequences of amino acids may be
expected to differ from one leader sequence to another and from one host
to another, but the requirement of a preferred amino acid sequence in the
NH.sub.2 terminus of mature proteins may be expected in general to render
the mature protein processable by a particular leader sequence.
According to the invention with respect to the DT leader sequence in E.
coli and strains known to exchange genetic information therewith in
nature, the NH.sub.2 -terminal amino acid sequence of the mature protein
will conform to a consensus sequence of about 7 amino acids. The consensus
sequence comprises an ordered group of amino acids having characteristic
hydrophobicity and polarity. This consensus sequence is exemplified by the
amino acid sequences of amino terminus of mature diphtheria toxin in which
the sequence is NH.sub.2 -gly-ala-asp-asp-val-val-asp. More broadly, the
consensus sequence may be defined as gly-B, C, D, E, F, and G wherein B is
a mildly hydrophobic amino acid with low polarity, C, D and G are polar
amino acids, and at least one of E and F are hydrophobic amino acids with
low or no polarity.
As will be seen in detail hereinbelow, the NH.sub.2 -terminal amino acid
sequence of Pseudomonas exotoxin A, wherein this amino acid sequence has
an additional NH.sub.2 -terminal glycine, i.e.,
gly-ala-glu-glu-ala-phe-asp, also falls within the 7 amino acid consensus
sequence. Furthermore, the NH.sub.2 -terminal amino acid sequence of human
CSF-1 when this amino acid sequence has additional NH.sub.2 -terminal
glycine-alanine, i.e., gly-ala-glu-glu-val-ser-glu, also conforms to the 7
amino acid consensus sequence as defined above. The amino acid sequence of
mature CSF-1 is known. See Kawasaki et al., Science, 230: 297-296 (1985)
and U.S. patent application Ser. No. 876,810 filed June 20, 1986, the
disclosures of which are incorporated herein by reference.
The consensus sequence may be further defined as follows: B has a
hydrophobicity of 0.87, C D and G each have a hydrophobicity of greater
than 0.60, and less than 1.0, and a polarity of at least 49, and E and F
have a polarity of greater than 0 to about 1.0 and a hyrophobicity of at
least about 0.85. Known amino acids having the characteristics of B
include alanine. Amino acids having the characteristics of C, D and G
include asp, glu, his and arg. Known amino acids having the
characteristics of E and F include val, leu, phe and ile.
As described and summarized in Kubota et al., J. Theor. Biol., 91: 347-361
(1981), the physical characteristics of amino acids are well known and
have been tabulated according to the determinations of polarity and
hydrophobicity as described in Zimmerman et al., J. Theor. Biol., 21: 170.
The invention thus includes a variety of DNA sequences encoding specific
amino acid sequences falling within the definition of the consensus
sequence. Such DNA sequence will be particularly useful when the active
site of the mature protein resides in amino acid sequences that do not
include the NH.sub.2 terminal sequence. Thus, the consensus sequence may
be created by adding a DNA sequence encoding the consensus sequence to the
5' end of a DNA sequence encoding a protein that is desired to be
secreted.
The present invention also encompasses expression vectors comprising the
DNA sequence encoding the DT leader sequence and a DNA sequence
heterologous to the DT leader encoding the amino terminus of a mature
protein compatible with the DT leader. In such expression vectors, the DNA
sequence encoding the mature protein is in reading frame with the DT
leader sequence and the DNA sequence encoding the consensus sequence will
comprise the 5' end of the mature heterologous protein.
As mentioned above, and shown in detail hereinbelow, the consensus sequence
may be constructed by site specific mutagenesis. Alternatively it may be
formed by the addition of specific oligodeoxyribonucleotides in the region
where the consensus sequence is required. In general, such oligonucleotide
additions may be performed by digestion of the DNA with specific
endonucleases followed optionally by repair and blunt or sticky end
ligation to the paired oligodeoxyribonucleotide. DNA sequences encoding
part or all of the consensus sequence may be inserted in this manner.
Whether the DNA sequence comprising the consensus sequence is formed by
site specific mutagenesis, or oligonucleotide addition and subsequent
joining to the DNA sequence encoding the leader, is a matter of choice
that will depend upon the number of amino acid residues required to be
added, changed or deleted. The approach selected is within the choice of
the ordinarily skilled person to which this art pertains.
The expression vector will generally have control sequences including
promoter, ribosome binding site transcription, and translation initiation
and stop signals that are operable in the particular host in which the
mature protein is to be expressed. In general, the promoter and ribosome
binding site will be selected to give high levels of expression at the
desired time in the growth of the host cell culture. Such promoters as the
trp promoter and RBS and P.sub.L promoter and gene N-ribosome binding site
are inducable by trp starvation and temperature, respectively, and permit
expression of the mature protein at the desired time.
As mentioned above, the translation initiation codon may be selected for
maximum operability in the host cell into which the expression vector is
transformed. In the case of the DT leader sequence when transformed into
E. coli, it is preferred that the translation initiation codon be changed
from GTG of the native DT leader to ATG which is the translation
initiation codon preferred by E. coli. The host cell transformed with the
expression vector according to the invention, may be selected from a
variety of hosts that are known to exchange genetic information with E.
coli in nature. Such natural exchanges are known to those skilled in the
art and are listed as among those microorganisms that are exempt from the
containment provisions of the Guidelines for Recombinant DNA, a volume
published from time to time in the United States Federal Register.
The general principle of the invention of conforming the DNA sequence
encoding at the NH.sub.2 -terminal amino acids of a mature protein to the
NH.sub.2 -terminal sequence of the mature protein that normally functions
with the particular leader, is applicable to a variety of host cells
including a variety of prokaryotic and eukaryotic cells. In general, it is
desirable to use a signal sequence that functions in the desired host cell
and to carry out such alterations to the DNA sequence encoding a select
mature protein that will make the N-terminus of the selected protein
resemble the NH.sub.2 -terminus of the protein that is produced with the
particular signal protein. In the present invention, the NH.sub.2
-terminal sequence of the mature protein, as exemplified, is modified so
as to have a consensus sequence similar to that of mature diphtheria toxin
A since the diphtheria toxin A leader is used in this instance.
The host cell, at the least, processes the continuous peptide including the
leader and mature protein and cleaves the mature protein from the leader
sequence. As is exemplified hereinbelow with respect to the Pseudomonas
exotoxin, new and unexpected properties may arise as a result of the
alterations to the amino terminal end of the mature protein. When
processed by the host cell, the mature Pseudomonas exotoxin has an
NH.sub.2 -terminal glycine added to the known Pseudomonas exotoxin amino
acid sequence. Where as Pseudomonas exotoxin heretofore produced in E.
coli, as demonstrated by Gray et al, supra, is not secreted from E. coli,
NH.sub.2 -gly-Pseudomonas exotoxin according to the invention is secreted
through the host cell membrane and furthermore is found in the growth
medium outside of the host cell membrane. Thus, in addition to processing,
the invention also entails the secretion of the altered polypeptide
NH.sub.2 -gly-Pseudomonas exotoxin according to the invention. It will be
understood is a novel protein having the unexpected characteristic being
secretable by the host cell E. coli. Furthermore, the NH.sub.2
-gly-Pseudomonas exotoxin retains biological activity and may be used as
the toxin component in toxin conjugates with binding moieties that
selectively or specifically bind to target cells. Such selective binding
moieties may include antibodies and the selective binding fragments
thereof, such as F(ab) and F(ab') hormones, cytokines, such as TNF,
lymphokines, such as interleukin-1 or 2, and cell growth factors such as
transferrin, epidermal growth factor and bombesin. Such selective binding
moieties bind to receptors found on the cells to which the selective
binding molecules bind. Immunoconjugates also selectively bind to cells,
however, such binding is based generally upon affinity and avidity for a
particular epitope associated with the cell to which the immunoglobulin
portion of the immunoconjugate binds. Thus, toxin conjugates made with the
NH.sub.2 -gly-Pseudomonas exotoxin are intended to be within the scope of
the invention.
Other proteins may be altered such that the NH.sub.2 -terminus is processed
by the host cell in associated with the DT leader. CSF-1 as is described
in detail hereinbelow, has been produced with the amino acid gly-ala added
to the NH.sub.2 -terminus thereof, and is processed by E. coli, but forms
aggregates.
The invention will be better understood from the following examples which
are intended to be illustrative of the invention, but not limiting.
SPECIFIC EXAMPLES
Cloning of Pseudomonas Exotoxin A Gene
Pseudomonas aeruginosa strain PA103 was grown in liquid broth according to
known methods. The chromosomal DNA was extracted, purified using
CsCL-ethidium bromide density equilibrium centrifugation, and the DNA
resuspended in 10 mM Tris 0.1 mM EDTA pH 8.0. The gene was then cloned in
two segments (as a BamHI-BamHI fragment and a BglII-EcoRI fragment) to
prevent unregulated synthesis of an active gene in E. coli leading to
instability of the plasmid in E. coli.
Cloning of the BamHI-BamHI Fragment
For identification of the sequences representing for Pseudomonas exotoxin A
the following synthetic oligonucleotide, encoding for positions 1748-1768
of the published sequence (Gray et al., Proc. Natl. Acad. Sci. (USA), 81:
2645 (1984)) was prepared using an automated DNA synthesizer: 5'
CAGGGCGTTGCGGATCACCTG 3'. This oligonucleotide is hereinafter referred to
as LG. This 21-mer was used both in the comparison of the published map of
the toxin gene with that in the current strain, as well as in identifying
the desired constructions in the BamHI-BamHI and EcoRI-BglIII fragment
clonings.
First, the presence of a 1530 base pair BamHI-BamHI fragment predicted from
the above-indicated published sequence was confirmed for the strain used
in this study. Pseudomonas chromosomal DNA was restricted with BamHI under
conditions specified by the manufacturer and run on a 0.7% agarose gel. In
addition, labeled DNA fragments of known molecular weights were included
within the gel as markers. The DNA within the gel was nicked by treatment
with 250 mM HCl, denatured by treatment with 0.2N NaOH, 0.6M NaCl and
transferred to GeneScreen.TM. (NEN/Dupont), a microporous adsorptive
membrane used for a hybridization transfer and described in U.S. Pat. No.
4,455,370 by electrophoresis. Following fixation of the DNA to the matrix
by baking at 85.degree. C. for two hours, the filter was treated in
prehybridization buffer (6.times.SSC, 0.1% SDS, 5.times.Denhardt buffer,
50 mM NaP, pH 7.0, 100 .mu.g/ml sonicated calf thymus DNA), for 4-5 hours
at 42.degree. C. The synthetic probe LG was end-labeled using T4 DNA
kinase and P32-ATP, and hybridized to the filter in prehybridization
buffer (using only 25 .mu.g/ml sonicated calf thymus DNA) at 42.degree. C.
overnight. The filters were then washed at 42.degree. C. once in 0.1% SDS,
5.times.SSC, twice in 0.1% SDS, 2.times.SSC and once in 0.1% SDS
1.times.SSC. Following autoradiography, the 1530 base pair BamHI-BamHI
fragment was confirmed using the labeled molecular weight markers.
For cloning this fragment, a preparative amount of Pseudomonas chromosomal
DNA was size fractionated on an aragrose gel. Pseudomonas chromosomal DNA
was restricted with BamHI, EcoRI, and PstI (the EcoRI and PstI restriction
enzymes were included to decrease the viscosity of the DNA before running
on the agarose gel and do not cut within the desired BamHI-BamHI fragment)
phenol extracted, ethanol precipitated and run on a 0.7% agarose gel along
with molecular weight markers. Following staining of the gel with ethidium
bromide, the fragments in the size range encompassing 1530 base pairs were
cut out of the gel, electroeluted, run over elutip-d.TM. columns
(Schleicher and Schuell, Inc., Keene, NH USA), and ethanol precipitated.
The presence of the desired sequence was confirmed by running a small
fraction of the purified size-fractionated DNA on an agarose gel,
transferring to GeneScreen.TM. (New England Nuclear/DuPont, Boston, Mass.
USA) and hybridization to the oligonucleotide probe as described above.
The size-fractionated DNA was ligated to pBR322 that had been restricted
with BamHI and treated with bacterial alkaline phosphatase (hereinafter
"bapped") to prevent vector self-ligation. Following transformation of the
ligation mixture into E. coli strain DG98 using the CaCl.sub.2 method of
Cohen et al. (Proc. Nat. Acad. Sci. USA, 219: 2110-2114 (1972), ampicillin
resistant colonies were grown overnight and transferred to nitrocellulose
filters. The colonies on the filters were lysed using triton lytic buffer
(0.2% triton X-100, 0.05M Tris, 0.0625M EDTA), the DNA denatured using
0.5M NaOH, 1M NaCl, the filters neutralized using 0.5M Tris pH 8, 1M NaCl
and washed using 0.3M NaCl, 10 mM Tris pH 7.6, 1 mM EDTA. The DNA was
fixed to the filters by baking at 85.degree. C. for 4-5 hours and
hybridized to end-labeled synthetic oligonucleotide LG as described for
hybridizing the gel. Probe-positive clones were inocculated into liquid
broth, their DNA extracted and screened for the presence of the 1530 base
pair fragment by digestion with BamHI. One such clone containing the
desired fragment was designated pBRPsBm and was used in subsequent steps.
Cloning of the EcoRI-BglII Fragment.
The presence of the 1267 base pair EcoRI-BglII fragment predicted in the
published sequence was confirmed for the strain used in this study as
described above for the BamHI-BamHI fragment except that the chromosomal
DNA was restricted with EcoRI and BglIII.
For cloning, a preparative amount of size fractionated Pseudomonas
chromosomal DNA was purified as described above. Pseudomonas chromosomal
DNA was restricted with EcoRI and BglII according to the manufacture's
specifications, and run on a 0.7% agarose gel along with molecular weight
markers. Following staining with ethidium bromide, the proper size range
of DNA fragments was identified using the molecular weight markers, cut
out of the gel and electroeluted. This preparation was then purified by
running over an elutip-d column and ethanol precipitated. The presence of
the desired sequences was confirmed by running a small fraction of the
purified DNA on an analytical agarose gel, transferring GeneScreen.TM. and
probing with labeled synthetica oligonucleotide LG.
The size-fractionated DNA was ligated into pBR322 that had been restricted
with EcoRI and BamHI and bapped to prevent self-ligation. The ligation
mixture was transformed into E. coli strain DG98 and plated onto
ampicillin containing plates. The ampicillin resistant colonies were
screened for the presence of exotoxin A sequences by hybridization to
end-labeled LG as described above. Probe-positive colonies were
inocculated into liquid broth, grown at 37.degree. C. and their DNA
isolated using standard procedures. Since the ligation of a BglII sticky
end into a BamHI sticky end destroys both restriction sites, confirmation
for the presence of the desired fragments could not use digestion with
BglII and EcoRI. Instead, DNA from probe-positive clones were subjected to
several sets of enzymes. Digestion with the combination of BamHI and SalI
was expected to yield two fragments: a 553 base pair BamHI-SalI fragment
entirely within the cloned fragment, and a 530 base pair fragment
consisting of SalI-BglII sequence (254 bp) within the cloned fragment, and
a BamHI-SalI sequence (276 bp) within pBR322. Digestion with the
combination EcoRI and SalI was expected to yield two fragments: a 1013 bp
EcoRI-SalI fragment entirely within the cloned fragment, and a 530 Base
pair fragment consisting of a SalI-BglII sequence (254 bp) within the
cloned fragment and a BamHI-SalI sequence (276 bp) within pBR322. One
plasmid having the expected restriction pattern was designated pBRPsBglEc
and was used in subsequent steps.
Mutagenesis of the Sequence Encoding the Amino-Terminal End of The
Pseudomonas Exotoxin A Gene
There is some homology between the amino terminal ends of the mature
diphtheria toxin and Pseudomonas exotoxin A with respect to charged and
hydrophobic amino acids as shown below:
______________________________________
PT: Ala Glu Glu Ala Phe Asp
DT: Gly Ala Asp Asp Val Val Asp
______________________________________
Since it has been shown that the diphtheria toxin secretory leader is able
to secrete diphtheria toxin in E. coli (see Greenfield et al., Proc. Natl.
Acad. Sci. USA, 80:6853-6857 (1983)), it was reasoned that it may be able
to secrete Pseudomonas exotoxin A in this host if the amino terminal end
of the protein were properly aligned with the leader in a manner similar
to the diphtheria toxin sequences. To this end a glycine codon (GGG) was
added just prior to the first codon of the mature protein (the Ala codon).
In addition, a SmaI restriction site (CCCGGG) was also added to permit
easy in-frame junction to other sequences such as the diphtheria toxin
leader.
Cloning the 1530 BamHI-BamHI fragment into M13.
In order to accomplish the alteration of the Pseudomonas toxin sequences,
the 1530 bp BamHI-BamHI fragment described in IA above was cloned into
M13MP18. M1 | | |
