 |
Description  |
|
|
BACKGROUND OF THE INVENTION
Soluble DNA is known to exist in the blood of healthy individuals at
concentrations of about 5 to 10 ng/ml. It is believed that soluble DNA is
present in increased levels in the blood of individuals having autoimmune
diseases, particularly systemic lupus erythematosus (SLE) and other
diseases including viral hepatitis, cancer and pulmonary embolism. It is
not known whether circulating soluble DNA represents a specific type of
DNA which is particularly prone to appear in the blood. However, studies
indicate that the DNA behaves as double-stranded DNA or as a mixture of
double-stranded and single-stranded DNA, and that it is likely to be
composed of native DNA with single-stranded regions. Dennin, R. H., Klin.
Wochenschr. 57:451-456, (1979). Steinman, C. R., J. Clin. Invest.,
73:832-841, (1984). Fournie, G. J. et al., Analytical Biochem.
158:250-256, (1986). There is also evidence that in patients with SLE, the
circulating DNA is enriched for human repetitive sequence (Alu) containing
fragments when compared to normal human genomic DNA.
In patients with cancer, the levels of circulating soluble DNA in blood are
significantly increased. Types of cancers which appear to have a high
incidence of elevated DNA levels include pancreatic carcinoma, breast
carcinoma, colorectal carcinoma and pulmonary carcinoma. In these forms of
cancer, the levels of circulating soluble DNA in blood are usually over 50
ng/ml, and generally the mean values are more than 150 ng/ml. Leon et al.,
Can. Res. 37:646-650, 1977; Shapiro et al., Cancer 51:2116-2120, 1983.
Mutated oncogenes have been described in experimental and human tumors. In
some instances certain mutated oncogenes are associated with particular
types of tumors. Examples of these are adenocarcinomas of the pancreas,
colon and lung which have approximately a 75%, 50%, and 35% incidence
respectively, of Kirsten ras (K-ras) genes with mutations in positions 1
or 2 of codons 12. The most frequent mutations are changes from glycine to
valine (GGT to GTT), glycine to cysteine (GGT to TGT), and glycine to
aspartic acid (GGT to GAT). Other, but less common mutations of codon 12
include mutations to AGT and CGT. K-ras genes in somatic cells of such
patients are not mutated.
The ability to detect sequences of mutated oncogenes or other genes in
small samples of biological fluid, such as blood plasma, would provide a
useful diagnostic tool. The presence of mutated K-ras gene sequences in
the plasma would be indicative of the presence in the patient of a tumor
which contains mutated oncogenes. Presumably this would be a specific
tumor marker since there is no other known source of mutated K-ras genes.
Therefore, this evaluation may be useful in suggesting and/or confirming a
diagnosis. The amount of mutated K-ras sequences in the plasma may relate
to the size of the tumor, the growth rate of the tumor and/or the
regression of the tumor. Therefore, serial quantitation of mutated K-ras
sequences may be useful in determining changes in tumor mass. Since most
human cancers have mutated oncogenes, evaluation of plasma DNA for mutated
sequences may have very wide applicability and usefulness.
SUMMARY OF THE INVENTION
This invention recognizes that gene sequences (e.g., oncogene sequences)
exist in blood, and provides a method for detecting and quantitating gene
sequences such as from mutated oncogenes and other genes in biological
fluids, such as blood plasma and serum. The method can be used as a
diagnostic technique to detect certain cancers and other diseases which
tend to increase levels of circulating soluble DNA in blood. Moreover,
this method is useful in assessing the progress of treatment regimes for
patients with certain cancers.
The method of the invention involves the initial steps of obtaining a
sample of biological fluid (e.g., urine, blood plasma or serum, sputum,
cerebral spinal fluid), then deproteinizing and extracting the DNA. The
DNA is then amplified by techniques such as the polymerase chain reaction
(PCR) or the ligase chain reaction (LCR) in an allele-specific manner to
distinguish a normal gene sequence from a mutated gene sequence present in
the sample. In one embodiment where the location of the mutation is known,
the allele specific PCR amplification is performed using four pairs of
oligonucleotide primers. The four primer pairs include a set of four
allele-specific first primers complementary to the gene sequence
contiguous with the site of the mutation on the first strand. These four
primers are unique with respect to each other and differ only at the 3'
nucleotide which is complementary to the wild type nucleotide or to one of
the three possible mutations which can occur at this known position. The
four primer pairs also include a single common primer which is used in
combination with each of the four unique first strand primers. The common
primer is complementary to a segment of a second strand of the DNA, at
some distance from the position of the first primer.
This amplification procedure amplifies a known base pair fragment which
includes the mutation. Accordingly, this technique has the advantage of
displaying a high level of sensitivity since it is able to detect only a
few mutated DNA sequences in a background of a 10.sup.7 -fold excess of
normal DNA. The method is believed to be of much greater sensitivity than
methods which detect point mutations by hybridization of a PCR product
with allele-specific radiolabelled probes which will not detect a mutation
if the normal DNA is in more than 20-fold excess.
The above embodiment is useful where a mutation exists at a known location
on the DNA. In another embodiment where the mutation is known to exist in
one of two possible positions, eight pair of oligonucleotide primers may
be used. The first set of four primer pairs (i.e., the four unique,
allele-specific primers, each of which forms a pair with a common primer)
is as described above. The second set of four primer pairs comprises four
allele-specific primers complementary to the gene sequence contiguous with
the site of the second possible mutation on the sense strand. These four
primers are unique with respect to each other and differ at the terminal
3' nucleotide which is complementary to the wild type nucleotide or to one
of the three possible mutations which can occur at this second known
position. Each of these allele-specific primers is paired with another
common primer complementary to the other strand, distant from the location
of the mutation.
The PCR techniques described above preferably utilize a DNA polymerase
which lacks 3'exonuclease activity and therefore the ability to proofread.
A preferred DNA polymerase is Thermus aquaticus DNA polymerase.
During the amplification procedure, it is usually sufficient to conduct
approximately 30 cycles of amplification in a DNA thermal cycler. After an
initial denaturation period of 5 minutes, each amplification cycle
preferably includes a denaturation period of about 1 minute at 95.degree.
C., primer annealing for about 2 minutes at 58.degree. C. and an extension
at 72.degree. C. for approximately 1 minute.
Following the amplification, aliquots of amplified DNA from the PCR can be
analyzed by techniques such as electrophoresis through agarose gel using
ethidium bromide staining. Improved sensitivity may be attained by using
labelled primers and subsequently identifying the amplified product by
detecting radioactivity or chemiluminescense on film. Labelled primers may
also permit quantitation of the amplified product which may be used to
determine the amount of target sequence in the original specimen.
As used herein, allele-specific amplification describes a feature of the
method of the invention where primers are used which are specific to a
mutant allele, thus enabling amplification of the sequence to occur where
there is 100% complementarity between the 3' end of the primer and the
target gene sequence. Thus, allele-specific amplification is advantageous
in that it does not permit amplification unless there is a mutated allele.
This provides an extremely sensitive detection technique.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A and 1B are diagramatic representations of the amplification
strategy for the detection of a mutated K-ras gene with a mutation present
at a single known location of K-ras.
FIGS. 2A and 2B are diagramatic representations of the amplification
strategy for detection of a mutated K-ras gene with a mutation present at
a second of two possible locations of K-ras.
DETAILED DESCRIPTION OF THE INVENTION
The detection of mutated DNA, such as specific single copy genes, is
potentially useful for diagnostic purposes, and/or for evaluating the
extent of a disease. Normal plasma is believed to contain about 10 ng of
soluble DNA per ml. The concentration of soluble DNA in blood plasma is
known to increase markedly in individuals with cancer and some other
diseases. The ability to detect the presence of known mutated gene
sequences, such as K-ras gene sequences, which are indicative of a medical
condition, is thus highly desirable.
The present invention provides a highly sensitive diagnostic method
enabling the detection of such mutant alleles in biological fluid, even
against a background of as much as a 10.sup.7 -fold excess of normal DNA.
The method generally involves the steps of obtaining a sample of a
biological fluid containing soluble DNA, deproteinizing, extracting and
denaturing the DNA, followed by amplifying the DNA in an allele-specific
manner, using a set of primers among which is a primer specific for the
mutated allele. Through this allele-specific amplification technique, only
the mutant allele is amplified. Following amplification, various
techniques may be employed to detect the presence of amplified DNA and to
quantify the amplified DNA. The presence of the amplified DNA represents
the presence of the mutated gene, and the amount of the amplified gene
present can provide an indication of the extent of a disease.
This technique is applicable to the identification in biological fluid of
sequences from single copy genes, mutated at a known position on the gene.
Samples of biological fluid having soluble DNA (e.g., blood plasma, serum,
urine, sputum, cerebral spinal fluid) are collected and treated to
deproteinize and extract the DNA. Thereafter, the DNA is denatured. The
DNA is then amplified in an allele-specific manner so as to amplify the
gene bearing a mutation.
During deproteinization of DNA from the fluid sample, the rapid removal of
protein and the virtual simultaneous deactivation of any DNase is believed
to be important. DNA is deproteinized by adding to aliquots of the sample
an equal volume of 20% NaCl and then boiling the mixture for about 3 to 4
minutes. Subsequently, standard techniques can be used to complete the
extraction and isolation of the DNA. A preferred extraction process
involves concentrating the amount of DNA in the fluid sample by techniques
such as centrifugation.
The use of the 20% NaCl solution, followed by boiling, is believed to
rapidly remove protein and simultaneously inactivate any DNases present.
DNA present in the plasma is believed to be in the form of nucleosomes and
is thus believed to be protected from the DNases while in blood. However,
once the DNA is extracted, it is susceptible to the DNases. Thus, it is
important to inactivate the DNases at the same time as deproteinization to
prevent the DNases from inhibiting the amplification process by reducing
the amount of DNA available for amplification. Although the 20% NaCl
solution is currently preferred, it is understood that other
concentrations of NaCl, and other salts, may also be used.
Other techniques may also be used to extract the DNA while preventing the
DNases from affecting the available DNA. Because plasma DNA is believed to
be in the form of nucleosomes (mainly histones and DNA), plasma DNA could
also be isolated using an antibody to histones or other nucleosomal
proteins. Another approach could be to pass the plasma (or serum) over a
solid support with attached antihistone antibodies which would bind with
the nucleosomes. After rinsing the nucleosomes can be eluted from the
antibodies as an enriched or purified fraction. Subsequently, DNA can be
extracted using the above or other conventional methods.
In one embodiment, the allele-specific amplification is performed through
the Polymerase Chain Reaction (PCR) using primers having 3' terminal
nucleotides complementary to specific point mutations of a gene for which
detection is sought. PCR preferably is conducted by the method described
by Saiki, "Amplification of Genomic DNA", PCR Protocols, Eds. M. A.
Innis, et al., Academic Press, San Diego (1990), pp. 13. In addition, the
PCR is conducted using a thermostable DNA polymerase which lacks 3'
exonuclease activity and therefore the ability to repair single base
mismatches at the 3' terminal nucleotide of the DNA primer during
amplification. As noted, a preferred DNA polymerase is T. aquaticus DNA
polymerase. A suitable T. aquaticus DNA polymerase is commercially
available from Perkin-Elmer as AmpliTaq DNA polymerase. Other useful DNA
polymerases which lack 3' exonuclease activity include a Vent.sub.R
(exo-), available from New England Biolabs, Inc., (purified from strains
of E. coli that carry a DNA polymerase gene from the archaebacterium
Thermococcus litoralis), Hot Tub DNA polymerase derived from Thermus
flauus and available from Amersham Corporation, and Tth DNA polymerase
derived form Thermus thermophilus, available from Epicentre Technologies,
Molecular Biology Resource Inc., or Perkin-Elmer Corp.
This method conducts the amplification using four pairs of oligoucleotide
primers. A first set of four primers comprises four allele-specific
primers which are unique with respect to each other. The four
allele-specific primers are each paired with a common distant primer which
anneals to the other DNA strand distant from the allele-specific primer.
One of the allele-specific primers is complementary to the wild type
allele (i.e., is allele-specific to the normal allele) while the others
have a mismatch at the 3' terminal nucleotide of the primer. As noted, the
four unique primers are individually paired for amplification (e.g., by
PCR amplification) with a common distant primer. When the mutated allele
is present, the primer pair including the allele-specific primer will
amplify efficiently and yield a detectable product. While the mismatched
primers may anneal, the strand will not be extended during amplification.
The above primer combination is useful where a mutation is known to exist
at a single position on an allele of interest. Where the mutation may
exist at one of two locations, eight pair of oligonucleotide primers may
be used. The first set of four pair is as described above. The second four
pair or primers comprises four allele-specific oligonucleotide primers
complementary to the gene sequence contiguous with the site of the second
possible mutation on the sense strand. These four primers differ at the
terminal 3' nucleotide which is complementary to the wild type nucleotide
or to one of the three possible mutations which can occur at this second
known position. Each of the four allele specific primers is paired with a
single common distant primer which is complementary to the antisense
strand upstream of the mutation.
During a PCR amplification using the above primers, only the primer which
is fully complementary to the allele which is present will anneal and
extend. The primers having a non-complementary nucleotide may partially
anneal, but will not extend during the amplification process.
Amplification generally is allowed to proceed for a suitable number of
cycles, i.e., from about 20 to 40, and most preferably for about 30. This
technique amplifies a mutation-containing fragment of the target gene with
sufficient sensitivity to enable detection of the mutated target gene
against a significant background of normal DNA.
The K-ras gene has point mutations which usually occur at one or two known
positions in a known codon. Other oncogenes may have mutations at known
but variable locations. Mutations with the K-ras gene are typically known
to be associated with certain cancers such as adenocarcinomas of the lung,
pancreas, and colon. FIGS. 1A through 2B illustrate a strategy for
detecting, through PCR amplification, a mutation occurring at position 1
or 2 of the 12th codon of the K-ras oncogene. As previously noted,
mutations at the first or second position of the 12th codon of K-ras are
often associated with certain cancers such as adenocarcinomas of the lung,
pancreas, and colon.
Referring to FIGS. 1A and 1B, the DNA from the patient sample is separated
into two strands (A and B), which represent the sense and antisense
strands. The DNA represents an oncogene having a point mutation which
occurs on the same codon (i.e., codon 12) at position 1 (X.sub.1). The
allele-specific primers used to detect the mutation at position 1, include
a set of four P1 sense primers (P1-A), each of which is unique with
respect to the others. The four P1-A primers are complementary to a gene
sequence contiguous with the site of the mutation on strand A. The four
P1-A primers preferably differ from each other only at the terminal
3'nucleotide which is complementary to the wild type nucleotide or to one
of the three possible mutations which can occur at this known position.
Only the P1-A primer which is fully complementary to the
mutation-containing segment on the allele will anneal and extend during
amplification.
A common downstream primer (P1-B), complementary to a segment of the B
strand downstream with respect to the position of the P1-A primers, is
used in combination with each of the P1-A primers. The P1-B primer
illustrated in FIG. 1 anneals to the allele and is extended during the
PCR. Together, the P1-A and P1-B primers identified in Table 1 and
illustrated in FIG. 1B amplify a fragment of the oncogene having 161 base
pairs.
FIGS. 2A and 2B illustrate a scheme utilizing an additional set of four
unique, allele-specific primers (P2-A) to detect a mutation which can
occur at codon 12 of the oncogene, at position 2 (X.sub.2). The
amplification strategy illustrated in FIGS. 1A and 1B would be used in
combination with that illustrated in FIGS. 2A and 2B to detect mutations
at either position 1 (X.sub.1) or position 2 (X.sub.2) in Codon 12.
Referring to FIGS. 2A and 2B, a set of four unique allele-specific primers
(P2-A) are used to detect a mutation present at a position 2 (X.sub.2) of
codon 12. The four P2-A primers are complementary to the genetic sequence
contiguous with the site of the second possible mutation. These four
primers are unique with respect to each other and preferably differ only
at the terminal 3' nucleotide which is complementary to the wild type
nucleotide or to one of the three possible mutations which can occur at
the second known position (X.sub.2).
A single common upstream primer (P2-B) complementary to a segment of the A
strand upstream of the mutation, is used in combination with each of the
unique P2-A primers. The P2-A and P2-B primers identified in Table 1 and
illustrated in FIG. 2B will amplify a fragment having 146 base pairs.
During the amplification procedure, the polymerase chain reaction is
allowed to proceed for about 20 to 40 cycles and most preferably for 30
cycles. Following an initial denaturation period of about 5 minutes, each
cycle, using the AmpliTaq DNA polymerase, typically includes about one
minute of denaturation at 95.degree. C., two minutes of primer annealing
at about 58.degree. C., and a one minute extension at 72.degree. C. While
the temperatures and cycle times noted above are currently preferred, it
is noted that various modifications may be made. Indeed, the use of
different DNA polymerases and/or different primers may necessitate changes
in the amplification conditions. One skilled in the art will readily be
able to optimize the amplification conditions.
Exemplary DNA primers which are useful in practicing the method of this
invention to detect the K-ras gene, having point mutations at either the
first or second position in codon 12 of the gene, are illustrated in Table
1.
TABLE 1
______________________________________
Primers Used to Amplify (by PCR) Position 1
and 2 Mutations at Codon 12 of K-ras Gene
(5'-3')
Sequence* Strand P1 or P2
______________________________________
GTGGTAGTTGGAGCTG A P1
GTGGTAGTTGGAGCTC A P1
GTGGTAGTTGGAGCTT A P1
GTGGTAGTTGGAGCTA A P1
CAGAGAAACCTTTATCTG B P1
ACTCTTGCCTACGCCAC A P2
ACTCTTGCCTACGCCAG A P2
ACTCTTGCCTACGCCAT A P2
ACTCTTGCCTACGCCAA A P2
GTACTGGTGGAGTATTT B P2
______________________________________
*Underlined bases denote mutations.
The primers illustrated in Table 1 are, of course, merely exemplary.
Various modifications can be made to these primers as is understood by
those having ordinary skill in the art. For example, the primers could be
lengthened or shortened, however the 3' terminal nucleotides must remain
the same. In addition, some mismatches 3 to 6 nucleotides back from the 3'
end may be made and would not be likely to interfere with efficacy. The
common primers can also be constructed differently so as to be
complementary to a different site, yielding either a longer or shorter
amplified product.
In one embodiment, the length of each allele-specific primer can be
different, making it possible to combine multiple allele-specific primers
with their common distant primer in the same PCR reaction. The length of
the amplified product would be indicative of which allele-specific primer
was being utilized with the amplification. The length of the amplified
product would indicate which mutation was present in the specimen.
The primers illustrated in Table 1 and FIGS. 1B and 2B, and others which
could be used, can be readily synthesized by one having ordinary skill in
the art. For example, the preparation of similar primers has been
described by Stork et al., Oncogene, 6:857-862, 1991.
Other amplification methods and strategies may also be utilized to detect
gene sequences in biological fluids according to the method of the
invention. For example, another approach would be to combine PCR and the
ligase chain reaction (LCR). Since PCR amplifies faster than LCR and
requires fewer copies of target DNA to initiate, one could use PCR as
first step and then proceed to LCR. Primers such as the common primers
used in the allele-specific amplification described previously which span
a sequence of approximately 285 base pairs in length, more or less
centered on codon 12 of K-ras, could be used to amplify this fragment,
using standard PCR conditions. The amplified product (approximately a 285
base pair sequence) could then be used in a LCR or ligase detection
reaction (LDR) in an allele-specific manner which would indicate if a
mutation was present. Another, perhaps less sensitive, approach would be
to use LCR or LDR for both amplification and allele-specific
discrimination. The later reaction is advantageous in that it results in
linear amplification. Thus the amount of amplified product is a reflection
of the amount of target DNA in the original specimen and therefore permits
quantitation.
LCR utilizes pairs of adjacent oligonucleotides which are complementary to
the entire length of the target sequence (Barany F., PNAS 88: 189-193,
1991; Barany F., PCR Methods and Applications 1: 5-16, 1991). If the
target sequence is perfectly complementary to the primers at the junction
of these sequences, a DNA ligase will link the adjacent 3' and 5' terminal
nucleotides forming a combined sequence. If a thermostable DNA ligase is
used with thermal cycling, the combined sequence will be sequentially
amplified. A single base mismatch at the junction of the olignoucleotides
will preclude ligation and amplification. Thus, the process is
allele-specific. Another set of oligonucleotides with 3' nucleotides
specific for the mutant would be used in another reaction to identify the
mutant allele. A series of standard conditions could be used to detect all
possible mutations at any known site. LCR typically utilizes both strands
of genomic DNA as targets for oligonucleotide hybridization with four
primers, and the product is increased exponentially by repeated thermal
cycling.
A variation of the reaction is the ligase detection reaction (LDR) which
utilizes two adjacent oligonucleotides which are complementary to the
target DNA and are similarly joined by DNA ligase (Barany F., PNAS
88:189-193, 1991). After multiple thermal cycles the product is amplified
in a linear fashion. Thus the amount of the product of LDR reflects the
amount of target DNA. Appropriate labeling of the primers allows detection
of the amplified product in an allele-specific manner, as well as
quantitation of the amount of original target DNA. One advantage of this
type of reaction is that it allows quantitation through automation
(Nickerson et al., PNAS 87: 8923-8927, 1990).
Examples of suitable oligonucleotides for use with LCR for allele-specific
ligation and amplification to identify mutations at position 1 in codon 12
of the K-ras gene are illustrated below in Table 2.
TABLE 2
______________________________________
Oligonucleotides (5'-3') for use in LCR
Sequence* Strand P1 or P2
______________________________________
AGCTCCAACTACCACAAGTT A1 A
GCACTCTTGCCTACGCCACC A2-A A
GCACTCTTGCCTACGCCACA A2-B A
GCACTCTTGCCTACGCCACG A2-C A
GCACTCTTGCCTACGCCACT A2-D A
GGTGGCGTAGGCAAGAGTGC B1 B
AACTTGTGGTAGTTGGAGCT B2-A B
AACTTGTGGTAGTTGGAGCA B2-B B
AACTTGTGGTAGTTGGAGCC B2-C B
AACTTGTGGTAGTTGGAGCG B2-D B
______________________________________
*Underlined bases denote mutations.
During an amplification procedure involving LCR four oligonucleotides are
used at a time. For example, oligonucleotide A1 and, separately, each of
the A2 oligonucleotides are paired on the sense strand. Also,
oligonucleotide B1 and, separately, each of the B2 oligonucleotides are
paired on the antisense strand. For an LCD procedure, two oligonucleotides
are paired, i.e., A1 with each of the A2 oligonucleotides, for linear
amplification of the normal and mutated target DNA sequence.
The method of the invention is applicable to the detection and quantitation
of other oncogenes in DNA present in various biological fluids. The p53
gene is a gene for which convenient detection and quantitation could be
useful because alterations in this gene are the most common genetic
anomaly in human cancer, occurring in cancers of many histologic types
arising from many anatomic sites. Mutations of the p53 may occur at
multiple codons within the gene but 80% are localized within 4 conserved
regions, or "hot spots", in exons 5, 6, 7 and 8. The most popular current
method for identifying the mutations in p53 is a multistep procedure. It
involves PCR amplification of exons 5-8 from genomic DNA, individually, in
combination (i.e., multiplexing), or sometimes as units of more than one
exon. An alternative approach is to isolate total cellular RNA, which is
transcribed with reverse transcriptase. A portion of the reaction mixture
is subjected directly to PCR to amplify the regions of p53 cDNA using a
pair of appropriate oligonucleotides as primers. These two types of
amplification are followed by single strand conformation polymorphism
analysis (SSCP) which will identify amplified samples with point mutations
from normal DNA by differences in mobility when electrophoresed in
polyacrylamide gel. If a fragment is shown by SSCP to contain a mutation,
the latter is amplified by asymmetric PCR and the sequence determined by
the dideoxy-chain termination method (Murakami et al, Can. Res., 51:
3356-33612, 1991).
Further, the ligase chain reaction (LCR) may be useful with p53 since LCR
is better able to evaluate multiple mutations at the same time. After
determining the mutation, allele-specific primers can be prepared for
subsequent quantitation of the mutated gene in the patient's plasma at
multiple times during the clinical course.
Preferably, the method of the invention is conducted using biological fluid
samples of approximately 5 ml. However, the method can also be practiced
using smaller sample sizes in the event that specimen supply is limited.
In such case, it may be advantageous to first amplify the DNA present in
the sample using the common primers. Thereafter, amplification can proceed
using the allele-specific primers.
The method of this invention may be embodied in diagnostic kits. Such kits
may include reagents for the isolation of DNA as well as sets of primers
used in the detection method, and reagents useful in the amplification.
Among the reagents useful for the kit is a DNA polymerase used to effect
the amplification. A preferred polymerase is Thermus aquaticus DNA
polymerase available from Perkin-Elmer as AmpliTaq DNA polymerase. For
quantitation of the mutated gene sequences, the kit can also contain
samples of mutated DNA for positive controls as well as tubes for
quantitation by competitive PCR having the engineered sequence in known
amounts.
The quantitation of the mutated K-ras sequences may be achieved using
either slot blot Southern hybridization or competitive PCR. Slot blot
Southern hybridization can be a performed utilizing the allele-specific
primers as probes under relatively stringent conditions as described by
Verlaan-de Vries et al., Gene 50:313-20, 1986. The total DNA extracted
from 5 ml of plasma will be slot blotted with 10 fold serial dilutions,
followed by hybridization to an end-labeled allele-specific probe selected
to be complementary to the known mutation in the particular patient's
tumor DNA as determined previously by screening with the battery of
allele-specific primers and PCR and LCR. Positive autoradiographic signals
will be graded semiquantitatively by densitometery after comparison with a
standard series of diluted DNA (1-500 ng) from tumor cell cultures which
have the identical mutation in codon 12 of the K-ras, prepared as slot
blots in the same way.
A modified competitive PCR (Gilliland et al., Proc. Nat. Acad. Sci., USA
87:2725:79; 1990; Gilliland et al., "Competitive PCR for Quantitation of
MRNA", PCR Protocols (Acad. Press), pp. 60-69, 1990) could serve as a
potentially more sensitive alternative to the slot blot Southern
hybridization quantitation method. In this method of quantitation, the
same pair or primers are utilized to amplify two DNA templates which
compete with each other during the amplification process. One template is
the sequence of interest in unknown amount, i.e. mutated K-ras, and the
other is an engineered deletion mutant in known amount which, when
amplified, yields a shorter product which can be distinguished from the
amplified mutated K-ras sequence. Total DNA extracted from the plasma as
described above will be quantitated utilizing slot blot Southern
hybridization, utilizing a radiolabelled human repetitive sequence probe
(BLURS). This will allow a quantitation of total extracted plasma DNA so
that the same amount can be used in each of the PCR reactions. DNA from
each patient (100 ng) will be added to a PCR master mixture containing P1
or P2 allele-specific primers corresponding to the particular mutation
previously identified for each patient in a total volume of 400 .mu.l.
Forty .mu.l of master mixture containing 10 ng of plasma DNA will be added
to each of 10 tubes containing 10 .mu.l of competitive template ranging
from 0.1 to 10 attomoles. Each reaction mixture will contain dNTPs (25
.mu.M final concentration including [.alpha.-.sup.32 P]dCTP at 50
.mu.Ci/ml), 50 pmoles of each primer, 2 mM MgCl.sub.2, 2 units of T.
aquaticus DNA polymerase, 1.times.PCR buffer, 50 .mu.g/ml BSA, and water
to a final volume of 40 .mu.l. Thirty cycles of PCR will be followed by
electrophoresis of the amplified products. Bands identified by ethidium
bromide will excised, counted and a ratio of K-ras sequence to deletion
mutant sequence calculated. To correct for difference in molecular weight,
cpm obtained for genomic K-ras bands will multiplied by 141/161 or
126/146, depending upon whether position 1 (P1) or position 2 (P2) primers
are used. (The exact ratio will depend upon the length of the deletion
mutant.) Data will be plotted as log ratio of deletion template DNA/K-ras
DNA vs. log input deletion template DNA (Gilliland et al. 1990a, 1990b).
A modified competitive PCR could also be developed in which one primer has
a modified 5' end which carries a biotin moiety and the other primer has a
5' end with a fluorescent chromophore. The amplified product can then be
separated from the reaction mixture by adsorption to avidin or
streptavidin attached to a solid support. The amount of product formed in
the PCR can be quantitated by measuring the amount of fluorescent primer
incorporated into double-stranded DNA by denaturing the immobilized DNA by
alkali and thus eluting the fluorescent single stands from the solid
support and measuring the fluorescence (Landgraf et al., Anal. Biochem.
182:231-235, 1991).
The competitive template preferably comprises engineered deletion mutants
with a sequence comparable to the fragments of the wild type K-ras and the
mutated K-ras gene amplified by the P1 and P2 series of primers described
previously, except there will be an internal deletion of approximately 20
nucleotides. Therefore, the amplified products will be smaller, i.e.,
about 140 base pairs and 125 base pairs when the P1 primers and P2 primers
are used, respectively. Thus, the same primers can be used and yet
amplified products from the engineered mutants can be readily
distinguished from the amplified genomic sequences.
Eight deletion mutants will be produced using the polymerase chain reaction
(Higuchi et al., Nucleic Acids Res. 16:7351-67 1988); Vallette et al.,
Nucleic Acids Res. 17:723-33, 1989; Higuchi, PCR Technology, Ch. 6, pp.
61-70 (Stockton Press, 1989)). The starting material will be normal
genomic DNA representing the wild-type K-ras or tumor DNA from tumors
which are known to have each of the possible point mutations in position
one and two of codon 12. The wild-type codon 12 is GGT. The following
tumor DNA can be used:
First position codon 12 mutations
______________________________________
G.fwdarw.A A549
G.fwdarw.T* Calul, PR371
G.fwdarw.C A2182, A1698
______________________________________
Second position codon 12 mutations
______________________________________
G.fwdarw.A* Aspcl
G.fwdarw.T* SW480
G.fwdarw.C 818-1, 181-4, 818-7
______________________________________
(*G.fwdarw.T transversions in the first or second position account for
approximately 80% of the point mutations found in pulmonary carcinoma and
GAT (aspartic acid) or GTT (valine) are most common in pancreatic cancer.
The deletion mutants with an approximately 20 residue deletion will be
derived as previously described (Vallette et al. 1989). In summary, the P1
and P2 primers will be used in an allele-specific manner with the normal
DNA or with DNA from the tumor cell line with each specific mutation. Each
of these would be paired for amplification with a common primer which
contains the sequence of the common primer normally used with either the
P1 and P2 allele-specific primers, i.e., "P1-B" or "P2-B" at the 5' end
with an attached series of residues representing sequences starting
approximately 20 bases downstream, thus spanning the deleted area (common
deletion primer 1 and 2, CD1 and CD2). The precise location and therefore
sequence of the 3' portion of the primer will be determined after analysis
of the sequence of the ras gene in this region with OLIGO (NB1, Plymouth,
MN), a computer program which facilitates the selection of optimal
primers. The exact length of the resultant amplified product is not
critical, so the best possible primer which will produce a deletion of
20-25 residues will be selected. For example, with P2 primers the
allele-specific primer for the wild-type will be 5' ACTCTTGCCTACGCCAC 3'
complementary to residues 35 to 51 in the coding sequence. To effect a
deletion of approximately 20 residues in the complementary strand, the
common upstream primer to be used with the wild-type and the three
allele-specific primers for mutations in position two of codon 12 will be
40 residues long (CD2) complementary to residues -95 to -78 (the currently
preferred common upstream primer for use with P2 allele-specific primers
and residues at approximately -58 to -25). The amplified shorter product
will be size-separated by gel electrophoresis and purified by Prep-a-Gene
(Biorad). DNA concentrations will be determined by the ethidium bromide
staining with comparison to dilutions of DNA of known concentration. This
approach will be repeated eight times, using the four P1 primers and
common primer (CD1) constructed as above, and four times with the four P2
primers and common primer (CD2). These deletion mutants will be amplified,
using the same allele-specific primers used to amplify the genomic DNA.
Therefore, they can be used subsequently in known serial dilutions in a
competitive PCR, as outlined above.
The invention is further illustrated by the following non-limiting
examples.
EXAMPLE 1
Blood was collected in 13.times.75 mm vacutainer tubes containing 0.05 ml
| | |
