|
Description  |
|
|
FIELD OF THE INVENTION
This invention is directed to methods of detecting prostate cancer
micrometastasis.
BACKGROUND OF THE INVENTION
Prostate cancer metastasis will claim the lives of over 30,000 Americans
this year. Boring et al., Cancer Statistics 1991, 19. The mode of
dissemination however, remains very poorly understood. An almost dogmatic
view of metastasis holds that prostate cancer cells first spread through
the prostatic capsule then into the lymphatics, and eventually
hematogenously travel to bone. Byar et al., Cancer 1972, 30, 5; Winter, C.
C., Surg. Gynecol. Obstet. 1957, 105, 136; Hilaris et al., Am. J.
Roentgenol. 1974, 121, 832; McLaughlin et al., J. Urol. 1976, 115, 89;
Jacobs, S. C., Urology 1983, 21, 337; Batson, O. V., Ann. Surg. 1940,
112,138; Saitoh et al., Cancer 1984, 54, 3078-3084; Whitmore, W. F., Jr.,
Cancer 1973, 32, 1104. However, this model has been based on
histopathologic studies which have significant limitations, and in
actuality the sequence of metastatic events remain unknown. Solid tumor
animal experiments suggest that only 0.01% of circulating cancer cells
eventually create a single metastatic deposit. Fidler et al., Science
1982, 217,998- 1001; Liotta et al., Cancer Res. 1974, 34, 997;
Schirrmacher, B., Adv. Cancer Res. 1985, 43, 1-32. Ostensibly, a single
bone metastasis from human prostatic adenocarcinoma (PAC) could be
generated by 10,000 circulating cancer cells (2 cells/1 ml blood). In the
past, detection of such a low concentration of cells has been difficult or
impossible. Recently, however, Wu et al. used keratin-19 (K-19) mRNA PCR
to detect breast cancer micrometastasis in patient lymph nodes and bone
marrow. Wu et al., Lab. Inv. 1990, 62, 109A. Miyomura et al., also
reported the detection of minimal residual acute lymphoblastic leukemia by
PCR in patients harboring the Philadelphia chromosome. Miyomura et al.,
Blood 1992, 79, 1366-1370.
A method of detecting the micrometastasis of prostate cancer would be
greatly desirable.
SUMMARY OF THE INVENTION
In accordance with the present invention, methods of detecting prostate
cancer micrometastasis in a patient are provided comprising the steps of
obtaining a sample of RNA from a patient's blood and amplifying said RNA
with polymerase chain reaction. The polymerase chain reaction is performed
using a pair of primers which are complementary to separate regions of the
prostate specific antigen gene. These primers may have the sequences
GAGGTCCACACACTGAAGTT (SEQ ID NO: 1) and CCTCCTGAAGAATCGATTCCT (SEQ ID NO:
2). Thereafter, the presence or absence of amplified RNA is detected
wherein the presence of amplified RNA indicates micrometastasis of
prostate cancer.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 shows an agarose gel in which micrometastasis is indicated by the
presence of a 214 base pair (bp) band.
DETAILED DESCRIPTION OF THE INVENTION
In accordance with methods of the present invention, methods of detecting
micrometastasis of prostate cancer in a patient is provided comprising the
step of obtaining a sample of RNA from the patient's blood. Preferably the
RNA is obtained from a blood sample such as a peripheral venous blood
sample. A whole blood gradient may be performed to isolate nucleated cells
and total RNA is extracted such as by the RNazole B method (Tel-Test Inc.,
Friendswood, Tex.) or by modification of methods known in the art such as
described in Sambrook et al., Molecular Cloning: A Laboratory Manual (Cold
Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).
Thereafter, a polymerase chain reaction may be performed on the total
extracted RNA. Preferably a reverse transcriptase PCR amplification
procedure may be performed in order to quantify the amount of mRNA
amplified. Polymerase chain reaction methodologies are well known in the
art. Innis et al., PCR Protocols, Academic Press, Inc., San Diego Calif.,
1990. Polymerase chain reaction primers may be designed to be
complementary to separate regions of the prostate specific antigen (PSA)
gene. Henttu et al., Biochem. Biophys. Res. Comm. 1989, 160, 903-910. By
separate regions is meant that a first primer is complementary to a 3'
region of the PSA gene and a second primer is complementary to a 5' region
of the PSA gene. Preferably, the primers are complementary to distinct,
separate regions and are not complementary to each other.
PSA is an important marker produced exclusively by prostatic epithelial
cells and almost always expressed by prostate cancer. Stamey et al., J.
Urol. 1989, 141, 1076-1083. Thus, PSA2 (5-GAGGTCCACACACTGAAGTT, SEQ ID NO:
1) and PSA3 (5-CCTCCTGAAGAATCGATTCCT, SEQ ID NO: 2) oligonucleotide
primers were designed to have high specificity to the PSA gene. A Gene
Bank version-70 (Mountain View, Calif.) search confirmed the specificity
of these primers to PSA and not to the human glandular kallikrein (HMGK)
gene which has high homology to the PSA gene. Henttu et al, Biochem.
Biophys. Res. Comm. 1989, 160, 903-910. PSA2 and PSA3 bind sequences that
span intron III of the PSA gene such that PCR amplification yields a 360
bp DNA which transcribes into a 214 bp RNA product, thereby eliminating
the possibility of false positives from DNA contamination. Oligonucleotide
primers may be prepared by methods known in the art such as by standard
phosphoramidite chemistry.
(See Sambrook et al., supra). Following amplification, the presence or
absence of mRNA amplification product may be detected. Preferably, the PCR
product may be run on an agarose gel and visualized using a stain such as
ethidium bromide. (See Sambrook et al., supra).
The following examples are illustrative but are not meant to be limiting of
the invention.
EXAMPLES
Example 1
Patient Specimens
Selection of cases was based on the following criteria. Prostate cancer
patients were chosen for analysis if they had: (1) clinically and/or
surgically staged DO-D2 disease (D0 =elevated tumor markers with no
demonstrable metastasis, D1 =pelvic lymph node involvement, D2
=disseminated disease usually to bone) without having received prior
hormonal therapy and who had an elevated serum PSA, or (2) stage D3
disease (D2 disease that is refractory hormonal therapy) with an elevated
PSA. Negative control patients consisted of female volunteers, and
patients with benign prostatic hypertrophy (BPH) proven by biopsy or men
who were on a BPH study protocol. Patients who had surgical manipulation
of the prostate during the previous year were excluded from the study.
Positive controls included a lymph node from a patient with known
metastatic PAC tissue from pathologically proven BPH and cDNA PSA plasmid.
Henttu et al, Biochem. Biophys. Res. Comm. 1989, 160, 903-910. The
protocol was IRB, The Internal Review Board of Thomas Jefferson University
Hospital, approved and written consent was obtained. LNCAP and PC3 human
cell lines were obtained from The American Type Culture Collection,
(Rockville, Md).
Example 2
Blood Preparation for RNA Extraction
Approximately six ml of venous blood were obtained with a standard
venipuncture technique using heparinized tubes. Whole blood was mixed with
an equal volume of phosphate buffered saline (PBS) which was then layered
over eight ml of Ficoll (Pharmacia Uppsala, Sweden) in a 15 ml polystyrene
tube. The gradient was centrifuged at 200 g for 30 minutes at 5.degree. C.
The lymphocyte and granulocyte layer (approximately 5 ml) was carefully
aspirated and re-diluted up to 50 ml with PBS in a 50 ml tube which was
then centrifuged at 1800 g for 20 minutes a 5 .degree. C. Supernatant was
discarded, and the pellet containing nucleated cells was used for RNA
extraction using the RNazole B method, as described by the company
(Tel-Test Inc., Friendswood, Tex.).
Example 3
Oligonucleotide primers and probes
PSA2 (5-GAGGTCCACACACTGAAGTT, SEQ ID NO: 1) and PSA3
(5-CCTCCTGAAGAATCGATTCCT, SEQ ID NO: 2) oligonucleotide primers were
custom designed with high specificity to the PSA gene; a Gene Bank
version-70 (Mountain View, Calif.) search confirmed the specificity of
these primers to PSA and not to the human glandular kallikrein (HMGK) gene
which is 75-85% homology to the PSA gene. Henttu et al, Biochem. Biophys.
Res. Comm. 1989, 160, 903-910. All primers were synthesized and gel
purified by the City of Hope DNA Synthesis Laboratory (Duarte, Calif.).
PSA2 and PSA3 bind sequences that span intron III such that PCR
amplification yielded a 360 bp DNA and a 214 bp RNA product. Previously
published actin PCR primer sequences were used to rule out degraded RNA,
and amplification with actin oligonucleotide primers A1 and A2 yielded a
154 bp RNA and a 250 bp DNA product. Ben-Ezra et al., J. Histochem
Cytochem. 1991, 39, 351-354.
Example 4
Polymerase Chain Reaction
The reverse transcriptase reaction and PCR amplification were performed
sequentially without interruption in a Perkin Elmer 9600 PCR machine
(Emeryville, Calif.). 400 ng of total RNA in 20 .mu.l DEPC
(Diethyl-pyrocarbonate) treated water were placed in a 65.degree. C. water
bath for five minutes then quickly chilled on ice immediately prior to the
addition of PCR reagents. The 50 .mu.l total PCR volume consisted of 2.5
units Taq polymerase (Perkin Elmer, Emeryville, Calif.), 2 units AMV
reverse transcriptase (Boehringer Mannheim, Indianapolis, Ind.), 200 .mu.M
each of dCTP, dATP, dGTP, and dTTP (Perkin Elmer, Emeryville, Calif.), 18
pM each primer, 10mMTris-HCL, 50 mMKCl, 2 mMMgCl.sub.22 (Perkin Elmer,
Emeryville, Calif.). PCR conditions were as follows: cycle 1 was
42.degree. C. for 15 minutes, then 97.degree. C. for 15 seconds (one
cycle); cycle 2 was 95.degree. C. for one minute, then 60.degree. C. for
one minute and 72.degree. C. for 30 seconds (15 cycles); cycle 3 was
95.degree. C. for one minute, then 60.degree. C. for one minute, and 72
degrees for one minute (10 cycles); cycle 4 was 95.degree. C. for one
minute, then 60 for one minute and 72.degree. C. for two minutes (8
cycles); cycle 5 was 72.degree. C. for 15 minutes (one cycle); and the
final cycle was a 4.degree. C. hold until sample was taken out of the
machine. The 50 .mu.l PCR products were concentrated down to 10 .mu.l with
vacuum centrifugation and the entire sample was then run on a thin three
percent Tris-borate-EDTA (TBE) agarose gel containing ethidium bromide.
All specimens were analyzed at least twice to confirm a positive or
negative outcome.
The potential risk of false positives from cross contamination was avoided
by performing RT PCR in a single tube without interruption and using
filtered pipet tips. Sensitivity was enhanced by using high amounts of Taq
polymerase, progressively increasing extension times, and analyzing the
entire 50 .mu.l PCR product on thin ethidium bromide agarose gels. These
measures ensured a high fidelity assay while maintaining technical
simplicity.
Prostate human tissue specimens, tissue culture cell lines and a PSA cDNA
plasmid, cloned and described by Henttu and Vihko; Henttu et al., Biochem.
Biophys. Res. Comm. 1989, 160, 903-910, were used as positive controls,
and they demonstrated the 214 bp bands as shown in FIG.1 top panel. A
pelvic lymph node with metastatic PAC, a primary prostate cancer, and a
BPH specimen all produced strong PSA PCR signals. The LNCAP and PC-3 human
prostate cell lines produced weaker signals.
EXAMPLE 5
Sequencing
Specificity of these primers to the PSA gene was confirmed with DNA
sequence analysis of the amplified 214 bp fragment (FIG. 1 Negative
Controls) which in this segment had very little homology to the HMGK gene.
The 214 bp product was purified with a Qiagen PCR Product Purification kit
(Qiagen, Chatsworth, Calif.) as described by the manufacturer. One
microgram of the PCR product underwent a PCR sequencing reaction by using
the Taq DyeDeoxy Terminator Cycle sequencing kit in a Perkin-Elmer 9600
PCR Machine, as described by Applied Biosystems (Applied Biosystems,
Foster, Calif.). The sequenced product was purified using centri-sep
columns (Princeton Separations, Adelphia, N.J.) as described by the
company. This product was then analyzed with a ABI Model 373A DNA
sequencing system (Applied Biosystems, Foster, Calif.) integrated with a
Macintosh IIci computer.
Example 6
Detection of Circulating Hematogenous
Micrometastasis
Twelve prostate cancer patients and 17 control patients underwent RT PCR
analysis on PSA and actin RNA extracted from blood, as described in
Examples 1 through 4 All cases demonstrated satisfactory RNA quality by
actin PCR (FIG. 1, bottom row). Of the 12 human prostatic adenocarcinoma
(PAC) patients with metastatic disease, four cases (33%) had positive PSA
signals indicating the presence of prostatic epithelial cells in the
peripheral venous blood. These four cases consisted of two stage D1
patients, one stage D2 patient, and one stage D3 patient (N=1) (FIG. 1,
top row). The 17 negative controls, which consisted of eight volunteer
women and nine men with BPH, all had undetectable PSA mRNA by RT PCR.
These data indicate that RT PCR of the PSA RNA gene can be used to
specifically detect circulating hematogenous micrometastasis in patients
with stage D1-D3 pathology. These findings are in agreement with studies
by Hamby et al. who detected circulating PSA positive cells in patients
with metastatic prostate cancer by flow cytology and immunohistology.
Hamdy et al., Br. J. Urol. 1992, 69,392-396.
Micrometastasis was not detected in eight of twelve prostate cancer
patients consisting of two stage D3 patients, two stage D1 patients, and
four stage DO patients. In order to enhance the detection of
micrometastasis, analysis may focus on buffy coat cells. Results indicate
that the prostate cancer cells may be more concentrated in the "buffy
coat". The PSA signal was stronger in the RNA extracted from cells
obtained only from the "buffy coat"(FIG. 1, lane 8) compared to those
isolated from the entire Ficoll layer (FIG. 1, lane 7) in the same
prostate cancer patient. These findings are in agreement with those of
Harty et al. who found that prostatic epithelial cells migrate into the
"buffy coat". Harty et al., J. Surg. Res. 1979, 26, 411-416.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 2
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: Nucleic
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(iv) ANTI-SENSE: No
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
GAGGTCCACACACTGAAGTT20
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21
(B) TYPE: Nucleic
(C) STRANDEDNESS: Single
(D) TOPOLOGY: Linear
(iv) ANTI-SENSE: No
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
CCTCCTGAAGAATCGATTCCT21
* * * * *
|
|
|
|
|
Description  |
|