Nucleic acid probes for detection and/or quantitation of non-viral organisms

Claims

We claim:

1. A hybridization assay probe able to detect the presence of the Mycobacterium tuberculosis complex organisms Mycobacterium africamum, Mycobacterium boris, and Mycobacterium tuberculosis, comprising an otigonucleotide 10 to 100 nucleotides in length able to hybridize to a Mycobacterium tuberculosis complex nucleic acid target region present in each of Mycobacterium africamum, Mycobacterium bovis, and Mycobacterium tuberculosis to form a detectable target:probe duplex under selective hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, a region selected from the group consisting of:

bases 185-225 of E. coli 16S rRNA,

bases 540-575 of E. coli 23S rRNA,

bases 1155-1190 of E. coli 23S rRNA, and

bases 2195-2235 of E. coli 23S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region in Mycobacterium africahum, Mycobacterium bovis, and Mycobacterium tuberculosis, and said oligonucleotide does not hybridize to nucleic acid from Mycobacterium intracellulare or Mycobacterium avium to form a detectable non-target:probe duplex under said hybridization conditions.

2. The probe of claim 1, wherein said oligonucleotide comprises a sequence selected from the group consisting of:

5' TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG,

5' CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG

5' ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC,

5' CCATCACCACCCTCCTCCGGAGAGGAAAAGG,

5' CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC,

5' AGGCACTGTCCCTAAACCCGATTCAGGGTTC,

and sequences fully complementary and of the same length thereto.

3. The probe of claim 1, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA.

4. The probe of claim 3, wherein said target region corresponds to bases 185-225 of E. coli 16S rRNA.

5. The probe of claim 3, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of:

5' TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG,

5' CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG,

5' ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC and the sequences perfectly complementary thereto.

6. The probe of claim 1, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 540-575 of E. coli 23S rRNA.

7. The probe of claim 6, wherein said target region corresponds to bases 540-575 of E. coli 23S rRNA.

8. The probe of claim 6, wherein said 10 contiguous base region is present in a nucleic acid sequence selected from the group consisting of:

5' CCATCACCACCCTCCTCCGGAGAGGAAAAGG, and the sequence perfectly complementary thereto.

9. The probe of claim 1, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 1155-1190 of E. coli 23S rRNA.

10. The probe of claim 9, wherein said target region corresponds to bases 1155-1190 of E. coli 23S rRNA.

11. The probe of claim 1, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 2195-2235 of E. coli 23S rRNA.

12. The probe of claim 11, wherein said target region corresponds to bases 2195-235 of E. coli 23S rRNA.

13. The probe of claim 11, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of:

5' CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC,

5' AGGCACTGTCCCTAAACCCGATTCAGGGTTC, and the sequences perfectly complementary thereto.

14. The probe of any of claims 3-3 wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 10 contiguous nucleotides.

15. The probe of claim 14, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 10 contiguous nucleotides.

16. The probe of claim 15, wherein said selective hybridization assay conditions comprise 0.12M phosphate buffer containing equimolar amounts of Na.sub.2 HPO.sub.4 and NaH.sub.2 PO.sub.4, 1 mM EDTA and 0.02% sodium dodecyl sulfate at 65.degree. C.

17. The probe of claim 14, wherein said oligonucleotide is 15-50 bases in length.

18. A hybridization assay probe able to detect the presence of the Mycobacterium tuberculosis complex organisms Mycobacterium africanurn, Mycobacterium bovis, and Mycobacterium tuberculosis, comprising an oligonucleotide 15 to 100 nucleotides in length able to hybridize to a Mycobacterium tuberculosis complex nucleic acid target region present in each of Mycobacterium africanum Mycobacterium boris, and Mycobacterium tuberculosis to form a detectable target:probe duplex under selective hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, a region selected from the group consisting of:

bases 185-225 of E. coli 16S rRNA,

bases 540-575 of E. coli 23S rRNA,

bases 1155-1190 of E. coli 23S rRNA, and

bases 2195-2235 of E. coli 23S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 15 contiguous nucleotides present in said target region in Mycobacterium africanum, Mycobacterium boris, and Mycobacterium tuberculosis, and said oligonucleotide does not hybridize to nucleic acid from Mycobacterium intracellulare or Mycobacterium avium to form a detectable non-target:probe duplex under said hybridization conditions.

19. The probe of claim 18, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S r RNA.

20. The probe of claim 19, wherein said target region corresponds to bases 185-225 of E. coli 16S rRNA.

21. The probe of claim 19, wherein said target sequence of 15 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of:

5' TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG,

5' CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG,

5' ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC, and the sequences perfectly complementary thereto.

22. The probe of claim 18, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 540-575 of E. coli 23S rRNA.

23. The probe of claim 22, wherein said target region corresponds to bases 540-575 of E. coli 23S rRNA.

24. The probe of claim 22, wherein said 15 contiguous base region is present in a nucleic acid sequence selected from the group consisting of:

5' CCATCACCACCCTCCTCCGGAGAGGAAA, and the sequence perfectly complementary thereto.

25. The probe of claim 18, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 1155-1190 of E. coli 23S rRNA.

26. The probe of claim 25, wherein said target region corresponds to bases 1155-1190 of E. coli 23S rRNA.

27. The probe of claim 18, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 2195-2235 of E. coli 23S. rRNA.

28. The probe of claim 27, wherein said target region corresponds to bases 2195-2235 of E. coli 23S rRNA.

29. The probe of claim 27, wherein said 15 contiguous base region is present in a nucleic acid sequence selected from the group consisting of:

5' CTGTCCCTAAACCCGATTCATTTCGTGTTAGATGC,

5' AGGCACTGTCCCTAAACCCGATTCAGGGTTC, and the sequences perfectly complementary thereto.

30. The probe of any of claims 19-29, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 15 contiguous nucleotides.

31. The probe of claim 30, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 15 contiguous nucleotides.

32. The probe of claim 31, wherein said selective hybridization assay conditions comprise 0.12M phosphate buffer containing equimolar amounts of Na.sub.2 HPO.sub.4 and NaH.sub.2 PO.sub.4, 1 mM/DTA and 0.02% sodium dodecyl sulfate at 65.degree. C.

33. The probe of claim 31, wherein said oligonucleotide is 15-50 bases in length.

34. A method for determining whether a Mycobacterium tuberculosis complex organism may be present in a sample, comprising the steps of:

a) providing to said sample an oligonucleotide able to hybridize to a Mycobacterium tuberculosis complex nucleic acid target region present in each of Mycobacterium africahum, Mycobacterium bovis, and Mycobacterium tuberculosis to form a detectable target:probe duplex under hybridization assay conditions, said target region corresponding to, or perfectly complementary to a nucleic acid corresponding to, a region selected from the group consisting of:

bases 185-225 of E. coli 16S rRNA,

bases 540-575 of E. coli 23S rRNA,

bases 1155-1190 of E. coli 23S rRNA, and

bases 2195-2235 of E. coli 23S rRNA; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region in Mycobacterium africahum, Mycobacterium bovis, and Mycobacterium tuberculosis, and said oligonucleotide does not hybridize to nucleic acid from Mycobacterium intracellulare or Mycobacterium avium to form a detectable non-target:probe duplex under said hybridization conditions, and

b) detecting hybridization of said probe to nucleic acid present in said sample under said hybridization conditions.

35. The method of claim 34, wherein said oligonucleotide comprises a sequence selected from the group consisting of:

5' TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG,

5' CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG

5' ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC,

5' CCATCACCACCCTCCTCCGGAGACCAAAATGC,

5' CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC,

5' AGGCACTGTCCCTAAACCCGATTCAGGGTTC, and sequences fully complementary and of the same length thereto.

36. The method of claim 34, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 185-225 of E. coli 16S rRNA.

37. The method of claim 36, wherein said target region corresponds to bases 185-225 of E. coli 16S rRNA.

38. The method of claim 36, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of:

5' TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG,

5' CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG,

5' ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC, and the sequences perfectly complementary thereto.

39. The method of claim 34, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 540-575 of E. coli 23S rRNA.

40. The method of claim 39, wherein said target region corresponds to bases 540-575 of E. coil 23S rRNA.

41. The method of claim 39, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of:

5' CCATCACCACCCTCCTCCGGAGAGGAAAAGG, and the sequence perfectly complementary thereto.

42. The method of claim 34, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 1155-1190 of E. coli 23S rRNA.

43. The method of claim 42, wherein said target region corresponds to bases 1155-1190 of E. coli 23S rRNA.

44. The method of claim 34, wherein said target region corresponds to, or is perfectly complementary to a nucleic acid corresponding to, bases 2195-2235 of E. coli 23S rRNA.

45. The method of claim 44, wherein said target region corresponds to bases 2195-2235 of E. coli 23S rRNA.

46. The method of claim 44, wherein said target sequence of 10 contiguous nucleotides is present in a nucleic acid sequence selected from the group consisting of:

5' CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC,

' AGGCACTGTCCCTAAACCCGATTCAGGGTTC, and the sequences perfectly complementary thereto.

47. The method of any of claims 35-46, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 10 contiguous nucleotides.

48. The method of claim 47 wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 10 contiguous nucleotides.

49. The method of claim 48, wherein said oligonucleotide is 15-50 bases in length.

50. A hybridization assay probe able to detect the presence of the Mycobacterium tuberculosis complex organisms Mycobacterium africanum, Mycobacterium bovis, and Mycobacterium tuberculosis, comprising an oligonucleotide 10 to 100 nucleotides in length able to hybridize to a Mycobacterium tuberculosis complex nucleic acid target region present in each of Mycobacterium africanum, Mycobacterium boris, and Mycobacterium tuberculosis to form a detectable target:probe duplex under selective hybridization assay conditions, said target region having the sequence 5' CCCTACCCACACCCACCACAAGGT or the complement thereof; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region, and said oligonucleotide does not hybridize to nucleic acid from Mycobacterium intracellulare or Mycobacterium avium to form a detectable non-target:probe duplex under said hybridization conditions.

51. The probe of claim 50, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 10 contiguous nucleotides.

52. The probe of claim 51, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 10 contiguous nucleotides.

53. A method for determining whether a Mycobacterium tuberculosis complex organism may be present in a sample, comprising the steps of:

a) providing to said sample an oligonucleotide able to hybridize to a Mycobacterium tuberculosis complex nucleic acid target region present in each of Mycobacterium africamum, Mycobacterium bovis, and Mycobacterium tuberculosis to form a detectable target:probe duplex under hybridization assay conditions, said target region having the sequence 5' CCCTACCCACACCCACCACAAGGT or the complement thereof; wherein said oligonucleotide comprises a sequence which is at least 75% complementary to a target sequence of 10 contiguous nucleotides present in said target region, and said oligonucleotide does not hybridize to nucleic acid from Mycobacrerium intracellulare or Mycobacterium avium to form a detectable non-target:probe duplex under said hybridization conditions, and

b) detecting hybridization of said probe to nucleic acid present in said sample under said hybridization conditions.

54. The method of claim 53, wherein said oligonucleotide comprises a sequence which is at least 90% complementary to said target sequence of 10 contiguous nucleotides.

55. The method of claim 54, wherein said oligonucleotide comprises a sequence which is 100% complementary to said target sequence of 10 contiguous nucleotides.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The inventions described and claimed herein relate to probes and assays based on the use of genetic material such as RNA. More particularly, the inventions relate to the design and construction of nucleic acid probes and hybridization of such probes to genetic material of target non-vital organisms in assays for detection and/or quantitation thereof in test samples of, e.g., sputum, urine, blood and tissue sections, food, soil and water.

2. Introduction

Two single strands of nucleic acid, comprised of nucleotides, may associate ("hybridize") to form a double helical structure in which the two polynucleotide chains running in opposite directions are held together by hydrogen bonds (a weak form of chemical bond) between pairs of matched, centrally located compounds known as "bases." Generally, in the double helical structure of nucleic acids, for example, the base adenine (A) is hydrogen bonded to the base thymine (T) or uracil (U) while the base guanine (G) is hydrogen bonded to the base cytosine (C). At any point along the chain, therefore, one may find the base pairs AT or AU, TA or UA, GC, or CG. One may also find AG and GU base pairs in addition to the traditional ("canonical") base pairs. Assuming that a first single strand of nucleic acid is sufficiently complementary to a second and that the two are brought together under conditions which will promote their hybridization, double stranded nucleic acid will result. Under appropriate conditions, DNA/DNA, RNA/DNA, or RNA/RNA hybrids may be formed.

Broadly, there are two basic nucleic acid hybridization procedures. In one, known as "in solution" hybridization, both a "probe" nucleic acid sequence and nucleic acid molecules from a test sample are free in solution. In the other method, the sample nucleic acid is usually immobilized on a solid support and the probe sequence is free in solution.

A probe may be a single strand nucleic acid sequence which is complementary in some particular degree to the nucleic acid sequences sought to be detected ("target sequences"). It may also be labelled. A background description of the use of nucleic acid hybridization as a proceduresfor the detection of particular nucleic acid sequences is described in U.S. application Ser. No. 456,729, entitled "Method for Detection, Identification and Quantitation of Non-Viral Organisms," filed Jan. 10, 1983 (Kohne I), and U.S. application Ser. No. 655,365, entitled "Method For Detecting, Identifying and Quantitating Organisms and Viruses," filed Sep. 4, 1984 (Kohne II), both of which are incorporated by reference, together with all other applications cited herein.

Also described in those applications are methods for determining the presence of RNA-containing organisms in a sample which might contain such organisms, comprising the steps of bringing together any nucleic acids from a sample and a probe comprising nucleic acid molecules which are shorter than the rRNA subunit sequence from which it was derived and which are sufficiently complementary to hybridize to the rRNA of one or more non-vital organisms or groups of non-vital organisms, incubating the mixture under specified hybridization conditions, and assaying the resulting mixture for hybridization of the probe and any test sample rRNA. The invention is described to include using a probe which detects only rRNA subunit subsequences which are the same or sufficiently similar in particular organisms or groups of organisms and is said to detect the presence or absence of any one or more of those particular organisms in a sample, even in the presence of many non-related organisms.

We have discovered and describe herein a novel method and means for designing and constructing DNA probes for use in detecting unique rRNA sequences in an assay for the detection and/or quantitation of any group of non-vital organisms. Some of the inventive probes herein may be used to detect and/or quantify a single species or strain of non-viral organism and others may be used to detect and/or quantify members of an entire genus or desired phylogenetic grouping.

SUMMARY OF THE INVENTION

In a method of probe preparation and use, a single strand deoxyoligonucleotide of particular sequence and defined length is used in a hybridization assay to determine the presence or amount of rRNA from particular target non-viral organisms to distinguish them from their known closest phylogenetic neighbors. Probe sequences which are specific, respectively, for 16S rRNA variable subsequences of Mycobacterium avium, Mycobacterium intracellulare and the Mycobacterium tuberculosis-complex bacteria, and which do not cross react with nucleic acids from each other, or any other bacterial species or respiratory infectious agent, under proper stringency, are described and claimed. A probe specific to three 23S rRNA variable region subsequences from the Mycobacterium tuberculosis-complex bacteria is also described and claimed, as are rRNA variable region probes useful in hybridization assays for the genus Mycobacterium (16S 23S rRNA specific), Mycoplasma pneumoniae (5S and 16S rRNA-specific), Chlamydia trachomatis (16S and 23S rRNA specific), Enterobacter cloacae (23S rRNA specific), Escherichia coli (16S rRNA specific), Legionella (16S and 23S rRNA specific), Salmonella (16S and 23S rRNA specific), Enterococci (16S rRNA specific), Neisseria gonorrhoeae (16s rRNA specific), Campylobacter (16S rRNA specific), Proteus mirabilis (23S rRNA specific), Pseudomonas (23S rRNA specific), fungi (18S and 28S rRNA specific), and bacteria (16S and 23S rRNA specific).

In one embodiment of the assay method, a test sample is first subjected to conditions which release rRNA from any non-viral organisms present in that sample. rRNA is single stranded and therefore available for hybridization with sufficiently complementary genetic material once so released. Contact between a probe, which can be labelled, and the rRNA target may be carried out in solution under conditions which promote hybridization between the two strands. The reaction mixture is then assayed for the presence of hybridized probe. Numerous advantages of the present method for the detection of non-vital organisms over prior art techniques, including accuracy, simplicity, economy and speed will appear more fully from the detailed description which follows.

BRIEF DESCRIPTION OF THE DRAWING

FIG. 1 is a chart of the primary structure of bacterial 16S rRNA for Escherichia coli, depicting standard reference numbers for bases.

FIG. 2 is a chart of the primary structure of bacterial 23S rRNA for Escherichia coli, depicting standard reference numbers for bases.

FIG. 3 is a chart of the primary structure of bacterial 5S rRNA for Escherichia coli, depicting standard reference numbers for bases.

FIG. 4 is a chart of the primary structure for the 18S rRNA for Saccharomyces cerevisiae, depicting standard reference numbers for bases.

FIG. 5 is a chart of the primary structure for the 28S rRNA for Saccharomyces cerevisiae, depicting standard reference numbers for bases.

FIG. 6 is a diagram showing the locations in the 16S rRNA (using E. coli reference numbers) which differ bertween 12 different sets of related organisms. In Example 1, for example, 99.7 refers to the difference in 16s rRNA between Clostridium botuliniumg and Clostridium subterminale.

FIG. 7 is a diagram showing the locations in the first 1500 bases of 23S rRNA (using E.coli reference numbers) which differ between 12 different sets of related organisms.

FIG. 8 is a diagram showing the locations in the terminal bases of 23S rRNA (using E.coli reference numbers) which differ between 12 different sets of related organisms.

FIG. 9 is a schematic representation of the location of probes capable of hybridizing to the 16S rRNA.

FIG. 10 is a schematic representation of the location of probes capable of hybridizing to the first 1500 bases of the 23S rRNA.

FIG. 11 is a schematic representation of the location of probes capable of hybridizing to the terminal bases of 23S rRNA.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

The following terms, as used in this disclosure and claims, are defined as:

nucleotide: a subunit of a nucleic acid consisting of a phosphate group, a 5' carbon sugar and a nitrogen containing base. In RNA the 5' carbon sugar is ribose. In DNA, it is a 2-deoxyribose. The term also includes analogs of such subunits.

nucleotide polymer: at least two nucleotides linked by phosphodiester bonds.

oligonucleotide: a nucleotide polymer generally about 10 to about 100 nucleotides in length, but which may be greater than 100 nucleotides in length.

nucleic acid probe: a single stranded nucleic acid sequence that will combine with a complementary single stranded target nucleic acid sequence to form a double-stranded molecule (hybrid). A nucleic acid probe may be an oligonucleotide or a nucleotide polymer.

hybrid: the complex formed between two single stranded nucleic acid sequences by Watson-Crick base pairings or non-canonical base pairings between the complementary bases.

hybridization: the process by which two complementary strands of nucleic acids combine to form double stranded molecules (hybrids).

complementarity: a property conferred by the base sequence of a single strand of DNA or RNA which may form a hybrid or double stranded DNA:DNA, RNA:RNA or DNA:RNA through hydrogen bonding between Watson-Crick base pairs on the respective strands. Adenine (A) usually complements thymine (T) or Uracil (U), while guanine (G) usually complements cytosine (C).

stringency: term used to describe the temperature and solvent composition existing during hybridization and the subsequent processing steps. Under high stringency conditions only highly homologous nucleic acid hybrids wi