WikiPatents - Community Patent Review
Create Free Account  |  License or Sell Your Patent  |  WikiPatents Marketplace  |  WikiPatents Blog
Username:  Password:  
    
Advanced Search
Nucleic acid probes useful for detecting microorganisms associated with vaginal infections    
United States Patent5654418   
Link to this pagehttp://www.wikipatents.com/5654418.html
Inventor(s)Sheiness; Diana K. (Bothell, WA); Cangelosi; Gerard A. (Seattle, WA); Britschgi; Theresa B. (Seattle, WA)
AbstractThe present invention relates to nucleic acid probes useful for the detection of microorganisms associated with vaginal disorders, for example Gardenerella vaginalis, Trichomonas vaginalis and Candida albicans.
   














 Title Information Submit all comments and votes
 
Patent Text Patent PDF Print Page Summary File History
Plain text PDF images Print Summary File History
Inventor     Sheiness; Diana K. (Bothell, WA); Cangelosi; Gerard A. (Seattle, WA); Britschgi; Theresa B. (Seattle, WA)
Owner/Assignee     Becton Dickinson and Company (Franklin Lakes, NJ)
Patent assignment
All assignments
Publication Date     August 5, 1997
Application Number     08/460,344
PAIR File History     Application Data   Transaction History
Image File Wrapper   Patent Term   Fees
Litigation
Filing Date     June 2, 1995
US Classification     536/24.32 536/24.3
Int'l Classification     C07H 021/04
Examiner     Horlick; Kenneth R.
Assistant Examiner    
Attorney/Law Firm     Highet, Esq.; David W.
Address
Parent Case     This is a Division of application Ser. No. 08/133,598 filed Oct. 8, 1993, which is a continuation-in-part application of U.S. patent application Ser. No. 07/896,094, filed May 29, 1992, abandoned, which is a continuation-in-part application of U.S. patent application Ser. No. 07/600,334, filed Oct. 19, 1990, now abandoned, both of which are incorporated herein by reference.
Priority Data    
USPTO Field of Search     536/24.32
Patent Tags     nucleic acid probes useful detecting microorganisms associated with vaginal infections
   
Enter a comma (,) or semicolon (;) between multiple tag words/phrases.
Describe this patent:
 Amusing   
 Clever   
 Complex   
 Efficient   
 Historic   
 Important   
 Innovative   
 Interesting   
 Practical   
 Simple   
[no votes]
Patent WIKI

Share information and news about this patent, including information and news about the technology, inventors, company, ligation and licensing.

 References Submit all comments and votes
 
*references marked with an asterisk below are user-added references
 U.S. References
 
Add a new US reference:  
ReferenceRelevancyCommentsReferenceRelevancyComments
5432271
Barns
536/24.32
Jul,1995

[0 after 0 votes]
5324632
Weisburg
435/6
Jun,1994

[0 after 0 votes]
4652517
Scholl
435/5
Mar,1987

[0 after 0 votes]
4727019
Valkirs
435/5
Dec,1969

[0 after 0 votes]
 Foreign References
 Other References
 Market Review Submit all comments and votes
   
Market Size
Estimate the gross annual revenues of the relevant market sector:
> $10B
$5B - $10B
$2B - $5B
$500M - $2B
$100M - $500M
$10M - $100M
$1M - $10M
$500K - $1M
$100K - $500K
< $100K
[No votes]
$0
 
$0   $2.5B   $5B   $7.5B   $10B
Market Share
Estimate the percentage of the relevant market sector this invention will capture:
75% - 100%
50% - 74.99%
25% - 49.99%
10 - 24.99%
5 - 9.99%
2 - 4.99%
1 - 1.99%
< 1%
[No votes]
0.0%
 
0%   25%   50%   75%   100%
Reasonable Royalty
What percentage of gross sales should the inventor or assignee be paid?
75% - 100%
50% - 74.99%
25% - 49.99%
10 - 24.99%
5 - 9.99%
2 - 4.99%
1 - 1.99%
< 1%
[No votes]
0.0%
 
0%   25%   50%   75%   100%
Public's "Guesstimation" of Royalty Value
Market SizeN/A[No votes]
xMarket ShareN/A[No votes]
xReasonable RoyaltyN/A[No votes]

N/A

License Availablity
If you are NOT the owner or assignee, answer here:
Yes, license is available for purchase

No, license is not currently available



[No votes]
License Availablity
If you ARE the owner or assignee, answer here:
Yes, license is available for purchase

No, license is not currently available



[No votes]
Competitive Advantage
Does this invention have a significant competitive advantage over similar technologies?
Yes

No



[No votes]
Most helpful competitive advantage comment
[No comments]

Commercial Alternatives
Are there viable commercial alternatives for this invention?
Yes

No



[No votes]
Most helpful commercial alternative comment
[No comments]

 Technical Review Submit all comments and votes
 Claims Submit all comments and votes
 


What is claimed is:

1. An oligonucleotide probe for the detection of at least one microorganism found in vaginal samples selected from the group consisting of Prevotella bivia, Prevotella melaninogenica, Gardnerella vaginalis, Trichomonas vaginalis, Mycoplasma hominis, Mobiluncus species, Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticus, Candida species, Streptococcus species and Enterobacteriaceae, wherein said probe is selected from the group consisting of:

for Prevotella bivia:

5'GGAACACGTTCCCCACTTATCCCC3' (SEQ. ID NO.: 1);

5'TGCCCTAGGTCGATCCTTACGGTC3' (SEQ. ID NO.: 2);

5'GGGATGCTTAATGCTTTCGCTTAG3' (SEQ. ID NO.: 3); and

5'TACGGTCACGAACTTCAGGCACCC3' (SEQ. ID NO.: 4);

for Prevotella melaninogenica:

5'GTCATTATCTCTAAATCCTTCCTC3' (SEQ. ID NO.: 5);

5'CAATCACCAGTTTTGCCCTAGGCC3' (SEQ. ID NO.: 6); and

5'GATCCTTGGGGTCACGGACTTCAG3' (SEQ. ID NO.: 7);

for Gardnerella vaginalis:

5'AGACGGCTCCATCCCAAAAGGGTT3' (SEQ. ID NO.: 18);

5'CACTCACCCAAAAGGCTTGCTCCC3' (SEQ. ID NO.: 19);

5'GTCCGANACAGAACCCGTGGAATG3' (SEQ. ID NO.: 20);

5'GGCCCCACATCCAGCGTCCACCGT3' (SEQ. ID NO.: 21);

' TACACTCACCCAAAAGGCTTGCTGCCC3' (SEQ. ID NO.: 22);

5'GTCCGACACAGAACCCGTGGAATG3' (SEQ. ID NO.: 23);

5'CCCCACATCCAGCGTCCACCG3' (SEQ. ID NO.: 24); 5'GGCCCCACATCCAGCGTCCA3' (SEQ. ID NO.: 25); and

5'GGCTTGCTGCCCAATCAAAAGCGGTTTAC3' (SEQ. ID NO.: 26);

for Mycoplasma hominis:

5'GTGATTCTCCACCGACTAATGATC3' (SEQ. ID NO.: 27);

5'CCGACAAGGTACCGTCAGTCTGCA3' (SEQ. ID NO.: 28);

5'CCATCTGTCACTCCGATAACCTCC3' (SEQ. ID NO.: 30); and

5'CTGACAAGGTACCGTCAGTCTGCA3' (SEQ. ID NO.: 33);

for Mobiluncus curtesii complex:

5'ACCATCAACACACCCAAAAGCATGCCTTT3' (SEQ. ID NO.: 34); and

5'ACCATCAACACAGCCAAAACTGTGCCTTT3' (SEQ. ID NO.: 35);

for Mobiluncus mulieris:

5'ACCATCAACACACCCAAAAGCATGCCTTT3' (SEQ. ID NO.: 34);

for Ureaplasma urealyticus:

' ATTTCCTATCTTAGCGTTTCTTCC3' (SEQ. ID NO.: 51); and

5'CCACCTGTCATATTGTTAACCTCA3' (SEQ. ID NO.: 52);

for Candida species:

5'GTCAATCCTTATTGTGTCTGGACCTGGT3' (SEQ. ID NO.: 13);

for Streptococcus agalactiae:

5'TACCGTCACTTGGTAGATTTTCCACTCC3' (SEQ. ID NO.: 42);

5'GATTTTCCACTCCTACCAACGTTCTTCTC3' (SEQ. ID NO.: 43);

5'CCTACCAACGTTCTTCTCTAACAACAGAGC3' (SEQ. ID NO.: 44);

5'GGTAGATTTTCCACTCCTACCAACGTTCTTCTC3' (SEQ. ID NO.: 45; and

5'GGTAGATTTTCCACTCCTACCAACGTTC3' (SEQ. ID NO.: 46);

for Streptococcus pyogenes:

' GATTTTCCACTCCCACCATCATTCTTCTC3' (SEQ. ID NO.: 47);

for Trichomonas vaginalis:

5'ATCCTNAAAGACCCGAAGCCTGTC3' (SEQ. ID NO.: 48);

5'ATCCTGAAAGACCCGAAGCCTGTC3' (SEQ. ID NO.: 49); and

5'GTCATAAAAACATCTGGTCCTGGTAAG3' (SEQ. ID NO.: 50);

for Enterobacteriaceae:

5'CATTACTCACCCGTCCGCCACTCGTC3' (SEQ. ID NO.: 17);

and combinations thereof and further, wherein N represents A, G, C or T.
 Description Submit all comments and votes
 


FIELD OF THE INVENTION

The present invention relates, in general, to compositions, methods and diagnostic kits useful for detecting microorganisms associated with vaginal disorders. In one aspect, the invention relates to methods for releasing intact nucleic acid from a microorganism. In another aspect, the invention relates to compositions of oligonucleotide probes for use in the detection of microorganisms associated with vaginal disorders. Methods for detection as well as diagnostic kits for the assay of these microorganisms are also disclosed.

BACKGROUND OF THE INVENTION

One of the most common reasons women seek medical treatment is for vaginal discharge or other vaginal symptoms. In women who visit their physician with vaginal complaint, approximately 40% are diagnosed as having some form of vaginitis, and 90% of these cases fall into three clinical entities: bacterial vaginosis (BV), trichomoniasis, and vulvovaginal candidiasis. (See, e.g., Sobel, "Vaginal Infections in Adult Women," Medical Clinics of North America 74:1573 (1990)). The symptoms of these three distinct diseases overlap, thus creating a need for differential diagnosis before appropriate and specific medication can be prescribed. A rapid and accurate diagnosis is especially critical in pregnant women, in whom BV and trichomoniasis are associated with premature births and low birth weight babies. Moreover, BV-positive pregnant women are predisposed to chorioamnionitis, amniotic fluid infection, and puerperal infectious morbidity. BV has also been associated with pelvic inflammatory disease, postpartum endometritis, bacteremia, salpingitis, and the like.

The term "bacterial vaginosis" was coined only a few years ago, the disease being formerly known as "leukorrhea" or "non-specific" vaginitis. Until the past decade, the cause of this syndrome was presumed to be some unidentified pathogen. A study published in 1955 suggested that Gardnerella vaginalis was the causative agent of BV, but this proposition was discredited by subsequent studies revealing that G. vaginalis was present in the vaginal secretions of 10-50% of normal women, i.e., BV-negative women. Since then it has become apparent that, unlike most diseases, BV cannot be attributed to one specific etiologic agent, but instead results from a drastic alteration of the vaginal flora. The normally present Lactobacilli become greatly reduced in number, and there is a concomitant overgrowth of several anaerobic bacteria and other microorganisms, especially Gardnerella vaginalis (Gv). This alteration is accompanied by an increase in vaginal pH.

The clinical "gold standard" method of diagnosing BV involves the examination of four criteria, and does not involve microbiological culture:

1) presence of clue cells (determined microscopically);

2) white or gray adherent homogeneous discharge;

3) vaginal fluid pH>4.5; and

4) fishy amine odor when vaginal fluid is mixed with 10% potassium hydroxide (KOH).

To diagnose BV, some investigators require the presence of clue cells plus two of the other three indicators, while other investigators require only that any three of the four indicators be present. In practice, physicians do not typically conduct pH and amine odor tests in their offices, nor even attempt to identify clue cells. In fact, use of the gold standard test is confined primarily to clinical studies. Identification of clue cells requires special skills, since such cells are difficult to distinguish from other microscopically observable entities. Clue cells are not microorganisms, but are vaginal epithelial cells that have been shed from the vaginal wall and to which a large number of rod-shaped bacteria have adhered. The adherent cells include G. vaginalis, and other anaerobic species including, for example, Mobiluncus species.

Another consistent hallmark of BV is the elevation of vaginal pH above the normal value of 4.5. Unfortunately, this highly sensitive indicator lacks specificity, as conditions other than BV can also cause an elevated vaginal pH. For example, infection with Trichomonas vaginalis or cervicitis can cause the vaginal pH to go up. Hence, vaginal pH by itself cannot be used to diagnose BV because such a practice would result in an unacceptable incidence of false positives.

In addition to the gold standard criteria, BV is sometimes diagnosed by assessing the shift in vaginal flora by examining Gram stained vaginal smears. This method, used primarily in research protocols, is difficult to perform and requires special training, thereby rendering it unsuitable for physician's offices. Moreover, this technique is less sensitive and less specific for BV than the gold standard method. (See, e.g., Nugent, et al., "Reliability of Diagnosing Bacterial Vaginosis Is Improved By A Standardized Method of Gram Stain," J. Clin. Microbiol. 29(2):297-301 (1991).

Currently, some physicians make use of a wet mount in conjunction with office vaginal examinations. A slide prepared from the patient's vaginal fluid is visually examined by the physician. When a BV-positive patient is examined by a physician practiced in making these difficult observations, such a slide will reveal an absence of the usual levels of Lactobacilli, which are large rods, and the presence of a large number of small rod-shaped bacteria, including Gardnerella vaginalis (Gv), Prevotella, and Mobiluncus species. The former two bacteria have straight rod shapes, while the latter bacterium exhibits a curved rod shape. Some physicians believe that clue cells may be identified through wet mount analysis, but such means of identification are not generally accepted as appropriate.

When fast isolated, G. vaginalis was termed Haemophilus vaginalis. Later, G. vaginalis was reclassified as Corynebacterium vaginalis. Finally, G. vaginalis was placed into a new genus, Gardnerella, as it did not properly belong in either of the first two classifications. As such, some investigators have attempted to determine whether the amount of G. vaginalis present in a sample is indicative of BV. In doing so, they concluded that BV-positive women, on the average, have higher levels of G. vaginalis than BV-negative women. Considerable overlap was found to exist in the levels of G. vaginalis found in BV-positive and BV-negative women, however, thereby rendering the G. vaginalis cell level inconclusive evidence of the disease state. See, Amsel, et al., Am. J. Med. 74:14-22, 1983 and Eschenbach, et al., Am. J. Obstet. Gynecol. 158:819-28, 1988.

BV is one common cause of vaginal complaints. Other microorganisms commonly associated with such symptoms are Candida species and Trichomonas vaginalis. The most typical way of diagnosing candidiasis is according to symptoms, visual inspection of the vagina, and microscopic detection of the organism itself. For the wet mount, potassium hydroxide is added to dissolve epithelial cells, and the slide is examined for the presence of yeast elements, for example, pseudohyphae or budding yeast. If these measures do not yield a definitive diagnosis, the physician may order a culture. An alternative to culture method is Gram stain, which requires a trained person to analyze the results.

The classical method for the diagnosis of Trichomonas involves demonstration that the organism is present. Trichomonas is not a normal inhabitant of the vagina, and is considered a pathogen anytime it is detected. Typically, detection is done microscopically by observing protozoa with characteristic motility in vaginal secretions mixed with saline in a wet mount. Since Candida wet mounts contain potassium hydroxide, separate wet mounts must be used if one wishes to look for both of these organisms. Detection of Trichomonas depends on observation of flagellated cells of a characteristic size and shape that are in motion. Unfortunately, trichomonads quickly lose their distinctive motility upon cooling to room temperature, therefore, a microscope and trained microscopist must be available immediately after the sample is taken. Once they have lost their motility, trichomonads are practically indistinguishable from lymphocytes present on the slide. To exacerbate the challenge of microscopically detecting trichomonads is the fact that they tend to be present in low numbers.

In view of the foregoing, it is readily apparent that there are numerous disadvantages associated with the use of culture for diagnosing vaginal disorders, particularly if the woman presents with symptoms of vaginitis. The foremost disadvantage is the three to seven days required to obtain culture results. This delay can lead doctors to avoid culture altogether and, instead, to dispense medication based on a less accurate method of microscopic examination of a wet mount.

Moreover, aside from the delay in getting the results, culture can be prohibitively expensive when the syndrome can be caused by three different etiologic agents, as is the case with vaginitis. Even if a patient were willing to pay, most commercial microbiology laboratories do not offer Trichomonas vaginalis culture. Moreover, even when this culture is available, logistical problems arise from trying to culture three organisms from a single patient. If one swab is used and placed into the standard bacterial transport medium, the Trichomonas will not survive. This fastidious organism requires a specialized transport medium. Hence, at least two swabs must be taken. In fact, the microbiologist would prefer a separate swab for each organism to be cultured. Yet if three swabs are taken, it is not likely that all three will pick up identical samples, as the successive swabs are likely to deplete the vaginal fluid, and may even cause irritation.

In the case of Gardnerella vaginalis and Candida albicans, culture is of limited utility because these organisms can be present in the non-diseased vagina. In many instances, culture for these organisms would have diagnostic value if it were designed to yield quantitative data that could be used to identify clinically significant levels of these organisms, a procedure that involves plating serial dilutions of each sample. But, routine culture protocols do not involve plating serial dilutions to identify clinically significant levels and, thus, they determine only whether the organism is present. At best, the microbiology laboratory will inform the physician whether the growth was heavy or light. This limited information is not sufficient for the diagnosis of BV or candidiasis.

Even if a method were available for analyzing a single swab for the presence of multiple organisms, there are numerous drawbacks of culture and wet mount. As such, a biochemical test would be more economical than culturing for several different organisms. Moreover, if the test could be performed in less than an hour, the diagnosis could be completed before the patient left the doctor's office, thus enabling her to obtain the correct medication that same day.

One advantage of culture is that the organism is given a chance to multiply before being identified. However, since a swab can pick up only limited amounts of sample, a successful biochemical method would have to possess the capability of detecting very small numbers of organisms. As such, a biochemical method performed in the doctor's office would have to be able to yield results from the minuscule amount of sample present on one or two swabs. For tests that rely on detecting cytoplasmic components of the pathogenic organisms, the detection step must be preceded by efficient disruption of cell walls and membranes. Unfortunately, many pathogens of the vagina, e.g., Candida albicans, Gardnerella vaginalis, and Group B streptococci, are extremely difficult to lyse compared with other microorganisms. Trichomonas lyses easily, but contains potent nucleases that can easily sabotage diagnostic tests based on detection of nucleic acids.

Moreover, different methods are currently required to lyse each of these organisms. As such, the prior art has not provided a general lysis method that is effective for the simultaneous disruption and release of nucleic acids for the several pathogens of the vagina. For diagnostic tests targeted to panels rather than single microorganisms, the use of a different lysis protocol for each organism would necessitate separate swabs for each, and the separate processing would drive up the cost of the test. As a practical matter, a single lysis protocol would be far more desirable.

One potential biochemical detection method involves the use of nucleic acid hybridization. The sequence specificity embodied in nucleic acids makes it possible to differentiate virtually any two species by nucleic acid hybridization. Standard techniques for detection of specific nucleotide sequences generally employ nucleic acids that have been purified away from cellular proteins and other cellular contaminants. The most common method of purification involves lysing the cells with sodium dodecyl sulfate (SDS), digesting with proteinase K, and removing residual proteins and other molecules by extracting with organic solvents such as phenol, chloroform, and isoamylalcohol.

Endogenous nucleases released during cell solubilization can frustrate efforts to recover intact nucleic acids, particularly ribonucleic acids (RNA). While deoxyribonucleses (DNases) are easily inactivated by the addition of chelating agents to the lysis solution, ribonucleases (RNases) are far more difficult to eliminate. RNases are ubiquitous, being present even in the oil found on human hands, and they are practically indestructible. For example, the standard procedure for preparing laboratory stocks of pancreatic RNase is to boil a solution of the enzyme for 15 minutes. The purpose of this treatment is to destroy all traces of contaminating enzyme activity, since other enzymes cannot survive boiling.

Accordingly, protecting against RNase is a commonly acknowledged aspect of any standard RNA preparation technique. Sambrook, et al., which is a compendium of commonly followed laboratory practices, recommends extensive precautions to avoid RNase contamination in laboratories where RNA work is conducted. All solutions that will contact RNA are to be prepared using RNase-free glassware, autoclaved water, and chemicals reserved for work with RNA that are dispensed exclusively with baked spatulas. Besides purging laboratory reagents of RNase, RNase inhibitors are typically included in lysis solutions. These are intended to destroy endogenous RNases that generally become activated during cell lysis.

From the above descriptions, it is evident that the standard nucleic acid purification techniques are not practical for the rapid and economical detection of specific microorganisms outside of a well-equipped laboratory. Protecting against RNase is cumbersome and costly, and typical extraction procedures require the handling of caustic solvents, access to water baths, fume hoods, and centrifuges, and even the storage and disposal of hazardous wastes. The direct analysis of unfractionated solubilized microorganisms would avoid the cost and inconvenience of these purification techniques.

A minimum prerequisite for identifying microorganisms by hybridization is the release of target nucleic acids from cellular structures that otherwise would impede entry of the detection probes. Such probes consist in general of segments of nucleic acid that are complementary to sequences unique to the target organism. Once the probe has formed a hybrid with the target, the existence of that hybrid can be ascertained by activating a signal generating system that is bound to the probe.

Various impediments can block the access of hybridization probes to their target sequences, the most significant barrier being the cell wall itself. While the cell walls of many microorganisms can be effectively solubilized with guanidinium salts or with proteinase K and SDS, these methods do not effectively release readily hybridizable nucleic acids from many clinically important microorganisms, e.g., Candida albicans and Gram positive species. The Gram positive bacteria, which are known to be difficult to lyse, also do not efficiently yield hybridizable nucleic acids after treatment with guanidinium salts or proteinase K.

In some instances, unusual mounts of endogenous nucleases have aggravated the problem of recovering intact nucleic acids. For example, one of the few groups that has successfully extracted intact DNA from Trichomonas vaginalis reports that this organism is characterized by a high level of endogenous nuclease activity, and that its DNA is unusually susceptible to degradation during isolation. See, Riley, et al., J. Clin. Microbiol., 30:465-472 (1992).

Moreover, the means available for lysing recalcitrant organisms are often complex and unwieldy. For example, a common method for the mechanical lysis of yeast requires the sample to be alternately vortexed with glass beads and cooled in an ice bath. The cellular extract is recovered by centrifugation after puncturing the bottom of the tube. Similarly, a Mini-Beadbeater.TM. has been used for lysing Mycobacterium species, where cells are ruptured by vigorous shaking with phenol and zirconium beads. See, Hurley, et al., Journal of Clinical Microbiology, 25:2227-2229 (1987).

The lysis of soil bacteria presents another challenge that has required drastic measures. Successful methods for their lysis have included multiple cycles of freeze-thawing, and passage through a French press, which is a high-pressure shearing device. One recent method for lysing these bacteria calls for the successive application of sonication, microwave heating, and thermal shocks. See, Picard, et al., Applied and Environmental Microbiology, 58:2717-2722 (1992).

Another common approach for lysis of microorganisms has involved enzymes that attack the cell walls. For example, lyticase has proven effective in lysing Candida albicans, while achromopeptidase, mutanolysin, or proteinase K removes cell walls from most Gram positive microorganisms. See, e.g., Kaneko, et al., Agr. Biol. Chem., 37:2295-2302 (1973); Bollet, et al., Nucleic Acids Research, 19:1955 (1991); Siegel, et al., Infection and Immunity, 31:808-815 (1981). However, the use of enzymes in routine detection protocols is fraught with disadvantages. Chief among these is cost, but calibration of stock solutions, lengthy incubation times, the need for low temperature storage, and limited shelf life also make the use of enzymes less than desirable for protocols involving rapid detection of microorganisms.

When the microorganisms to be detected are located in human clinical samples, additional concerns must be accommodated. For one, the presence of mucous can cause clinical samples from some sources to be viscous and unmanageable. A successful lysis procedure must disperse mucous and any other substances that may accompany the sample. Furthermore, the method of lysis must be compatible with conventional sampling techniques if they are to be widely accepted by the medical community. For example, samples from the vagina are customarily taken with a single cotton or dacron swab. Therefore, samples available for detection of vaginal pathogens normally will be limited to whatever material that can be eluted from such a swab.

In view of the foregoing, there exists a need for a simple and rapid method for releasing intact nucleic acid from both prokaryotic and eukaryotic microorganisms present in a single, biological sample. Moreover, there exists a need for a simple, fast and effective biochemical method which selectively detects the microorganisms associated with vaginitis, i.e., Gardnerella vaginalis, Trichomonas vaginalis and Candida albicans. The present invention remedies these needs by providing such methods.

SUMMARY OF THE INVENTION

In one aspect, the present invention provides a method for releasing intact nucleic acid from a microorganism, the method comprising: combining a complex biological sample containing the microorganism with a lysis solution comprising a low ionic strength buffer and a detergent, the lysis solution having a pH ranging from about 7.0 to about 12.0; and heating the combined solution to above about 65.degree. C. for more than about five minutes to release the nucleic acid from the microorganism in the absence of mechanical force. Using this method, a number of different cells (e.g., a prokaryote and a eukaryote) present in a single, biological sample can be effectively lysed without resorting to the use of enzymes, organic solvents, glass beads, or bulky machinery (e.g., a French press).

The present invention also provides a method and kit for selectively detecting a prokaryotic microorganism and a eukaryotic microorganism in a single, complex biological sample, the method comprising: (a) lysing the cells of the prokaryotic microorganism and the eukaryotic microorganism by combining the sample with a lysis solution, thereby releasing nucleic acid from the microorganisms; (b) contacting the nucleic acid released from the microorganisms, under hybridizing conditions, with an oligonucleotide capture probe that selectively hybridizes to the nucleic acid of the prokaryotic microorganism and an oligonucleotide capture probe that selectively hybridizes to the nucleic acid of the eukaryotic microorganism to form a prokaryotic microorganism-capture probe hybridization complex and a eukaryotic microorganism-capture probe hybridization complex, respectively; and (c) detecting the hybridization complexes as an indication of the presence of the prokaryotic microorganism and the eukaryotic microorganism in the sample.

Moreover, in another aspect of the present invention, a method and kit are provided for selectively detecting a Group I microorganism selected from the group consisting of gram positive bacteria, and at least one other Group II microorganism selected from the group consisting of yeasts, protozoa, mycoplasmas and gram negative bacteria in a single, complex biological sample, the method comprising: (a) lysing the cells of a Group I and a Group II microorganisms by combining the sample with a lysis solution, thereby intact nucleic acid from the microorganisms; (b) contacting the nucleic acid released from the microorganisms, under hybridizing conditions, with an oligonucleotide capture probe that selectively hybridizes to the nucleic acid of the Group I microorganism and an oligonucleotide capture probe that selectively hybridizes to the nucleic acid of the Group II microorganism to form a Group I microorganism-capture probe hybridization complex and a Group II microorganism-capture probe hybridization complex, respectively; and (c) detecting the hybridization complexes as an indication of the presence of the Group I microorganism and the Group II microorganism in the sample.

Using the methods of the present invention, the following exemplary organisms can be selectively detected in a single, biological sample: Gardnerella vaginalis, Trichomonas vaginalis, Candida species (e.g., C. albicans, C. glabrata, C. kefyr, C. krusei, C. parapsilosis and C. tropicalis), Group B Streptococci, Prevotella bivia, Ureaplasma urealyticum, Mobiluncus species, Mycoplasma species, Neisseria gonorrhea, Chlamydia species and Enterobacteriaceae.

In a further aspect, the present invention provides a method for determining whether a patient is afflicted with bacterial vaginosis (BV) that is fast, accurate, and does not require an individual skilled in identifying clue cells, evaluating wet mounts or the like to assess the results. The method comprising: (a) determining the pH of a vaginal sample obtained from the patient; (b) detecting the Gardnerella vaginalis (Gv) cell level in the vaginal sample in a time period of about 6 hours or less; and (c) determining that the patient is BV-positive if the pH value of the vaginal sample is greater than about 4.5 and the Gv cell level of the vaginal sample is greater than or equal to a critical Gv cell number.

The present invention also provides pharmaceutical and diagnostic kits for use in the methods of the present invention. For example, the present invention provides a diagnostic kit for selectively detecting a prokaryotic microorganism and a eukaryotic microorganism in a single, complex biological sample, the kit comprising: (a) a dipstick comprising a nonporous solid support having attached thereto at least two capture oligonucleotide-coated beads, wherein the first bead selectively hybridizes to the nucleic acid of a prokaryotic microorganism and the second bead selectively hybridizes to the nucleic acid of a eukaryotic microorganism to form a prokaryotic microorganism-capture probe hybridization complex and a eukaryotic microorganism-capture probe hybridization complex, respectively; and (b) a container including at least two signal oligonucleotides, wherein the first signal oligonucleotide hybridizes to the prokaryotic microorganism and the second signal oligonucleotide hybridizes to the eukaryotic microorganism. Additionally, the present invention a diagnostic kit for determining whether a patient is afflicted with bacterial vaginosis (BV), the kit comprising: (a) a first indicator capable of indicating a pH greater than about 4.5; and (b) a second indicator capable of indicating a Gv cell level greater than or equal to a critical Gv cell number.

Other advantages, objects, features and embodiments of the present invention will become apparent from the detailed description which follows.

DETAILED DESCRIPTION OF THE INVENTION AND PREFERRED EMBODIMENT

The present invention provides a method for releasing intact nucleic acid from a microorganism, the method comprising: combining a complex biological sample containing the microorganism with a lysis solution comprising a low ionic strength buffer and a detergent, the lysis solution having a pH ranging from about 7.0 to about 12.0; and heating the combined solution to above about 65.degree. C. for more than about five minutes to release the nucleic acid from the microorganism, wherein the lysis solution is capable of releasing intact nucleic acid from the microorganism in the absence of mechanical force.

As used herein, the term "nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single-stranded or double-stranded form and, unless otherwise limited, encompasses known analogs of natural nucleotides which can function in a similar manner as naturally occurring nucleotides. As used herein, the term "intact" nucleic acid refers to hybridizable nucleic acid, i.e., nucleic acid of a sufficient length such that it is capable of hybridizing to an oligonucleotide probe. The term "complex biological sample" is used herein to refer to a biological mixture, e.g., vaginal fluid, of nucleic acid (RNA and/or DNA) and non-nucleic acid. Such a complex biological mixture includes a wide range of eukaryotic and prokaryotic cells.

Moreover, as used herein, the term "microorganism" refers to both prokaryotic and eukaryotic microorganisms. The significant differences between eukaryotic and prokaryotic cells would lead one to believe that a simple, universal method for releasing intact nucleic acid from a microorganism would not work well for both kinds of cell, especially the difficult-to-lyse yeast and the gram-positive bacteria. It has been discovered, however, that the above lysis method works well for releasing intact nucleic acid from both eukaryotic and prokaryotic microorganisms, including, for example, gram-positive bacteria and yeast.

Eukaryotic cells are found in all vertebrates, protozoa, and fungi, while bacteria exhibit the more primitive prokaryotic cell type. Both eukaryotic and prokaryotic cells are surrounded by a lipid bilayer that selectively regulates which molecules may enter or leave the cell. The lipid bilayer can be ruptured or solubilized by a variety of means, such as suspending the cells in hypotonic solutions, or treating them with organic solvents, although such means do not necessarily inactivate nucleases.

In addition to the lipid bilayer, bacteria and some types of primitive eukaryotic cells are encased by a rigid cell wall that surrounds the entire cell, including the plasma membrane itself. In bacteria, this tough protective coat is composed of a carbohydrate matrix cross-linked by short polypeptide units. (See, Raven and Johnson, Biology, p. 87, Times Mirror/Mosby College Publishing, 2nd ed., 1989.) No eukaryotes possess cell walls with a chemical composition of this kind. The most common methods for lysing bacteria without organic solvents involve treating the bacteria with lytic enzymes. Lysozyme and mutanolysin are commonly used to lyse gram-negative and gram-positive bacteria, respectively, but these enzymes are totally ineffective in lysing eukaryotic cells.

Yeast, which is a type of fungus, also possesses cell walls, but these differ in composition from those of bacterial cell walls. Cell walls of yeast rely primarily on .beta.-1,3-glucans for their rigidity. Yeast cell walls are often stabilized by disulfide bonds that can be disrupted with mild reducing agents such as .beta.-mercaptoethanol. A number of enzymes, including lyticase, chitinase, and Novozym.TM., are effective in lysing some strains of yeast. The lyric activity of lyticase is attributable to both a .beta.-1,3,-glucanase and a protease and lyses yeast only in the presence of a reducing agent. (See, Scott and Schekman, J. Bacteriol. 142:414-423 (1980), for a description of lyticase). Novozym.TM., sold by Novo BioLabs, includes glucanase, proteinase, and chitinase activities. In experiments performed by Applicants, lyticase, but not Novozym.TM. or chitinase, was effective in lysing Candida albicans.

Bacteria can be differentiated to some extent according to the composition of their cell walls. Bacteria are commonly classified according to whether or not they take up color during a procedure known as the Gram stain. Cells that incorporate the stain, known as "gram-positive" bacteria, have a single, thick cell wall that retains the stain and results in their appearing purple under the microscope. Gram-negative bacteria have evolved thinner and more complex cell walls that do not retain the stain. Gram-positive and gram-negative bacteria often differ in their susceptibility to different kinds of antibiotics as well as in their susceptibility to various lysis protocols.

Gram-positive bacteria have proven to be exceptionally difficult to lyse compared with gram-negative bacteria. For example, gram-positive bacteria are resistant to the inexpensive egg white lysozyme commonly used to lyse gram-negative microbes (Siegel, et al., Infec. and Immun. 31:808-815 (1981)). As previously discussed, investigators have often resorted to the use of expensive enzymes to lyse gram-positive bacteria.

Of particular interest is the simultaneous lysis of several pathogenic microorganisms that infect the human vagina. These microorganisms include, but are not limited to, Gardnerella vaginalis, Prevotella bivia, Trichomonas vaginalis, Candida albicans, and several species of Group B streptococci. Of these, several are difficult to lyse by conventional means. Trichomonas vaginalis presents a problem because of its reportedly high endogenous level of nucleases. Candida albicans and the Group B streptococci are problematic because of their relatively impervious cell walls. Furthermore, the rapid and economical non-enzymatic lysis of both eukaryotic and prokaryotic organisms in the same reaction mix is a challenge not met by any method in the existing art.

As such, a new approach has been discovered that is effective for lysing a number of different kinds of cells without resorting to the use of enzymes, organic solvents, glass beads, or bulky machinery. As previously mentioned, the lysis method of the present invention consists of combining a complex biological sample containing the microorganism to be lysed with a lysis solution comprising a low ionic strength buffer and a detergent, the lysis solution having a pH ranging from about 7.0 to about 12.0; and heating the combined solution to above about 65.degree. C. for more than about five minutes to release the nucleic acid from the microorganism, wherein the lysis solution is capable of releasing intact nucleic acid from the microorganism in the absence of mechanical force.

In this lysis method, the lysis solution contains a buffer having an ionic strength ranging from about 15 mM to about 150 mM. Suitable buffers which can be used for maintaining the pH of the lysis solution include, but are not limited to, the following: brucine tetrahydrate, 4-(2-hydroxyethyl)-1-piperazinepropane sulfonic acid ("EPPS"), tris(hydroxymethyl)aminomethane ("TRIS"), N-tris(hydroxymethyl)methylglycine ("TRICINE"), glycinamide, N,N-bis(2-hydroxyethyl)glycine ("BICINE"), N-tris(hydroxymethyl)methyl-2-aminopropane sulfonic acid ("TAPS"), N-glycyl-glycine, histidine, boric acid, pyrophosphoric acid, ethanolamine, glycine, trimethylamine, cyclopentanetetra-1,2,3,4-carboxylic acid, carbonic acid, 3-cyclohexylamino-1-propanesulfonic acid ("CAPS"), EDTA, methylamine, dimethylamine, ethylmine, triethylamine, diethylamine, ascorbic acid, and phosphoric acid.

Detergents suitable for use in the lysis method of the present invention include, but are not limited to, the following: anionic detergents, cationic detergents, zwitterionic detergents and non-ionic detergents. Anionic detergents include, but are not limited to, the sodium salts of caprylic acid, cholic acid, 1-decanesulfonic acid, deoxycholic acid, glycocholic acid, glycodeoxycholic acid, lauryl sulfate ("SDS"), N-lauroylsarcosine, taurocholic acid, taurodeoxycholic acid. Cationic detergents include, but not limited to, cetylpyridinium chloride, dodecyltrimethylammonium bromide, hexadecyltrimethylammonium bromide, and tetradecyltrimethylammonium bromide. Zwitterionic detergents include, but are not limited to, CHAPS and CHAPSO. Non-ionic detergent including, but not limited to, n-decyl .beta.-D-glucopyranoside, digitonin, n-docedyl .beta.-D-glucopyranoside, n-dodecyl .beta.-D-maltoside, n-heptyl .beta.-D-glucopyranoside, n-octyl .beta.-D-glucopyranoside, n-octyl .alpha.-D-glucopyranoside, nonidet P-40, n-nonyl .beta.-D-glucopyranoside, and Triton X-100.

Additionally, the lysis solution can include a chelating agent (e.g., EDTA) and/or a preservative (e.g., ProClin.RTM.). In contrast to methods in the prior art, no enzymes or ribonuclease inhibitors are required in the lysis solution of the present invention. As such, a presently preferred formulation of the lysis solution used in the disclosed method for releasing intact nucleic acid from a microorganism is as follows: 91 mM N-tris(hydroxy-methyl)aminomethane; 0.5% sodium dodecyl sulfate; 5.0% N-lauroyl-sarcosine (optional); 10 mM EDTA, and 0.1% ProClin.RTM. 150.

The pH optima of the lysis solution will depend upon which microorganism(s) is being lysed. In the present format, the pH optima has been determined for a number of microorganisms of interest, including the bacteria Gardnerella vaginalis, Prevotella bivia, and Group B streptococci; the protozoan Trichomonas vaginalis; and the yeast Candida albicans. For Candida albicans, the optimal pH ranges from a pH of about 10 to about 11.5, but substantial lysis was observed across the entire pH range from about 6.0 to about 11.5. Likewise, Trichomonas vaginalis lysed well across the this entire range of pHs, with slightly better results at a pH above about 8.5. Gardnerella vaginalis lysed well across the entire range, with a slight decrease in assay signal at pHs above 9.5. The optimal pH for lysing Group B streptococci was a pH of about 6.0 to abut 8.0, but a substantial amount of lysis was seen at pHs ranging from about 7.0 to about 12.0.

It will be readily apparent to those of skill in the art that the pH optima for other microorganisms can readily be determined. For example, the lysis conditions for Group B streptococci were optimized using the following procedure. As a "gold standard" for comparison with the test samples set forth below, suspensions containing known numbers of freshly-grown bacteria were lysed with a solution containing about 1 mg/Ml mutanolysin, 2 mg/mL achromopeptidase, 2 mg/mL lysozyme, 2 mg/mL lipase-PN, and 10 mg/mL 20-T Zymolase. After incubating for about five minutes at 37.degree. C., proteinase K and SDS were added to final concentrations of about 1 mg/ml, and 1.5%, respectively. This mixture was incubated for an additional five minutes at 60.degree. C. This treatment was designed to ensure complete lysis by inclusion of all of the enzymes shown previously to effect lysis of Group B streptococci.

For the test samples, known numbers of freshly-gown bacteria were placed in a number of test vials and the following lysis solution was added to each sample: 91 mM N-tris(hydroxy-methyl)aminomethane; 0.5% sodium dodecyl sulfate; 5.0% N-lauroyl-sarcosine (optional); 10 mM EDTA, and 0.1% ProClin.RTM. 150. Holding all other factors the same, the pH of the lysis solution was varied over a pH ranging from about 5.0 to about 12.0. Similarly, holding all factors the same, the temperature of the lysis solution was varied over a wide range. The optimal lysis conditions for Group B streptococci were assessed by comparing the amount of ribosomal RNA detected in each test sample with the amount of ribosomal RNA detected in the gold standard lysis mixture. In doing so, it was determined that Group B streptococci became completely lysed at a temperature of about 85.degree. C., but substantial lysis was seen at temperatures exceeding 65.degree. C. The optimal pH for lysing Group B streptococci ranges from a pH of about 6.0 to about 8.0, but a substantial amount of lysis was seen at pH's ranging from about 7.0 to about 12.0. It will be readily apparent to those of skill that the pH optima for any microorganism can be determined using a procedure similar to that used for Group B streptococci.

In a presently preferred embodiment of the lysis method, the combined solution (i.e., the lysis solution and target microorganism) is heated to a temperature above about 65.degree. C. for a period of about five to about ten minutes. More preferably, the combined solution is heated to a temperature ranging from about 75.degree. C. to about 95.degree. C. Even more preferably, the combined solution is heated to a temperature of about 85.degree. C. If the lysis temperature exceeds 95.degree. C., little or no nucleic acid can be detected in the subsequent assays. As such, in contrast to previously used lysis methods, the use of enzymes, organic solvents, glass beads, or bulky machinery are not required in the lysis methods of the present invention.

As a result of this ability to lysis multiple microorganisms in a single, complex biological sample, assays of any combination of microorganisms discussed above can be conducted in the same reaction mixture, thereby making it possible to devise diagnostic assays for different microorganisms that may be present in the same complex biological sample, e.g., the same patient sample. This approach is useful for devising assays for pathogens all of which are associated with the same clinical symptoms. For example, the vaginitis organisms Gardnerella vaginalis, Candida albicans, and Trichomonas vaginalis can all be in a single sample if the microorganisms are first lysed to release their nucleic acid using the lysis method of the present invention. As such, a single sample from pregnant women can be assessed for the presence of multiple organisms which are known to cause premature birth. For example, a prenatal assay panel can include Trichomonas vaginalis, Prevotella bivia, Gardnerella vaginalis, and Group B streptococci or, a subset thereof. As this lysis method works on such a great variety of microorganisms, a wide variety of combinations of organisms can be assayed by analyzing single patient samples from any part of the body.

As such, in another aspect of the present invention, a method and kit are provided for selectively detecting a prokaryotic microorganism and a eukaryotic microorganism in a single, complex biological sample, the method comprising: (a) lysing the cells of the prokaryotic microorganism and the eukaryotic microorganism by combining the sample with a lysis solution, thereby releasing nucleic acid from the microorganisms; (b) contacting the nucleic acid released from the microorganisms, under hybridizing conditions, with an oligonucleotide capture probe that selectively hybridizes to the nucleic acid of the prokaryotic microorganism and an oligonucleotide capture probe that selectively hybridizes to the nucleic acid of the eukaryotic microorganism to form a prokaryotic microorganism-capture probe hybridization complex and a eukaryotic microorganism-capture probe hybridization complex, respectively; and (c) detecting the hybridization complexes as an indication of the presence of the prokaryotic microorganism and the eukaryotic microorganism in the sample.

In accordance with this method and kit of the present invention, a