 |
Description  |
|
|
FIELD OF THE INVENTION
This invention relates to diagnostics, research reagents, and therapies for
disease states which respond to modulation of the synthesis or metabolism
of cell proliferation-associated proteins. In particular, this invention
relates to oligonucleotides which inhibit the production of a group of
proteins which are synthesized in proliferating cells. Oligonucleotides
designed to hybridize to the mRNA encoding p120 are provided to effect
these goals. These oligonucleotides have been found to lead to modulation
of the synthesis and metabolism of cell proliferation-associated proteins.
Palliation and therapeutic effect result.
BACKGROUND OF THE INVENTION
Malignant neoplasms have several characteristics which distinguish them
from benign tumors and normal cells. These features include uncontrolled
cell growth, invasiveness and metastasis. Malignant tumors may be
differentiated from benign tumors or normal cells by morphological
characteristics including anaplastic cells, increased mitotic index,
abnormal mitotic cells, variable size and shape, increased nuclear to
cytoplasmic ratio, and large prominent nucleoli. Much research has been
focused on the biochemical and genetic characterization of malignant cells
attempting to identify differences responsible for these phenotypic
changes. Such studies have lead to the identification of so-called
"oncogenes" which, if overexpressed or mutated, promote malignant
transformation of cells.
Current agents which affect cellular proliferation are nonspecific
cytotoxic agents such as DNA alkylating agents, DNA intercalators or
microtubule depolymerizing agents. These agents all suffer from severe
toxicities and lack of specificity towards the malignant cell. Thus, there
is a long-felt need for molecules which effectively inhibit proliferation
of malignant cells. Oligonucleotides designed to hybridize with nucleic
acids encoding proliferation--associated proteins represent a novel
approach to selectively inhibit gene expression, in particular expression
of p120.
OBJECTS OF THE INVENTION
It is a principle object of the invention to provide therapies for diseases
with a component due to hyperproliferation of cells, such as malignancies,
inflammatory diseases and cardiovascular diseases, through perturbation in
the synthesis and expression of proliferating cell nucleolar antigens.
It is a further object of the invention to provide oligonucleotides and
other compositions which are capable of inhibiting the function of nucleic
acids encoding proliferation associated proteins.
A further object is to provide oligonucleotides which, regardless of
mechanism, inhibit the growth or development of malignant cells,
especially human breast carcinoma cells.
These and other objects of this invention will become apparent from a
review of the instant specification.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts screening of treatment conditions of cells with
oligonucleotides in accordance with the invention. Panel A shows a
representative growth curve of HeLa cells in serum-free medium treated
with antisense oligonucleotides SEQ ID NO: 3 (open diamonds), SEQ ID NO: 5
(open triangles), SEQ ID NO: 9 (filled circles) plus DOTMA for four hours.
Panel B shows a representative growth curve of HeLa cells in
serum-containing complete medium treated with antisense oligonucleotides
SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9 without DOTMA for twenty-four
hours. Panel C shows a representative growth curve of HeLa cells treated
with antisense oligonucleotide SEQ ID NO: 9 with DOTMA for four hours in
serum containing medium (filled squares) or in serum free medium (filled
circles), or DOTMA without antisense oligonucleotide in serum free medium
(triangles).
FIG. 2 depicts screenings of certain preferred oligonucleotides in
accordance with the invention showing inhibition of tumors. Panel A shows
data for 0.1 .mu.M SEQ ID NO: 14+DOTMA (open circles), 0.1 .mu.M SEQ ID
NO: 9+DOTMA (filled circles) and a control containing DOTMA without
oligonucleotide (filled triangles) against HeLa (human epitheloid cervix
carcinoma), Panel B shows data for 0.1 .mu.M SEQ ID NO: 14+DOTMA (open
circles), 0.1 .mu.M SEQ ID NO: 9+DOTMA (closed circles) and a control
(closed triangles) against LOX (human amelanotic melanoma) while Panel C
depicts 0.1 .mu.M and 1.0 .mu.M SEQ ID NO: 14+DOTMA (open circles), 0.1
.mu.M and 1.0 .mu.M SEQ ID NO: 9+DOTMA (closed circles) and a control
(closed triangles) against SN12A1 (human renal cell carcinoma) cell lines.
FIG. 3 depicts the inhibitory effect on cell growth of antisense
oligonucleotide SEQ ID NO: 9 (filled circle) in different human tumor cell
lines as compared to a control (filled triangle) containing DOTMA without
oligonucleotide. Panel A shows LOX cells treated with oligonucleotide in
the presence of DOTMA for 4 hours in serum-free medium. Panel B shows HRCC
(SN12A1) cells treated with oligonucleotide in the presence of DOTMA for 4
hours in serum free medium.
FIG. 4 depicts a dose-response curve of antisense oligonucleotide SEQ ID
NO: 9 for HeLa (filled circles) and LOX (filled triangles) cells. The cell
counts were converted to percent of control growth and all data from the
cell growth control experiments on two days after treatment were plotted
against oligonucleotide SEQ ID NO: 9 concentration. Each datum point of
the plots contains 3-9 experiments.
FIG. 5 depicts cell growth inhibitory effect of antisense oligonucleotide
SEQ ID NO: 9 on HeLa cells (FIG. 5A) or LOX cells (FIG. 5B). Single
treatment (filled circles) was for four hours, 1 day after seeding.
Repeated treatment (open circles) was for four hours on days 1 and 3 after
seeding. The control (filled triangle) contained DOTMA without
oligonucleotide.
FIG. 6 compares the cell growth inhibitory effect of antisense SEQ ID NO: 9
(closed circles), randomized SEQ ID NO: 15 (having the nucleotide
composition of SEQ ID NO: 9, but the sequence is randomized; open squares)
and sense SEQ ID NO: 16 (having the complementary sequence to SEQ ID NO:
9; open circles) and a control (closed triangles) containing DOTMA without
oligonucleotide on HeLa cells. The cells were treated with oligonucleotide
complexed with DOTMA for four hours.
FIG. 7 depicts a dose response curve depicting the tumor growth inhibitory
effect of antisense oligonucleotide SEQ ID NO: 9 on human LOX ascites
tumor in nude mice. Treatment was on days 1, 3, and 5 with oligonucleotide
SEQ ID NO: 9 with DOTMA (filled circles) and without DOTMA (open circles).
SUMMARY OF THE INVENTION
In accordance with the present invention, oligonucleotides are provided
which are designed to specifically hybridize with all or a portion of
nucleic acids encoding proliferation associated proteins. The
oligonucleotides are able to inhibit the production of the proliferation
associated proteins.
The mechanism of action of these oligonucleotides is unknown. They may
function to interfere with the function of mRNA; either its translation
into protein, its translocation into the cytoplasm, its transcription from
DNA or any other activity necessary to its overall biological function may
be affected. The failure of the RNA to perform all or part of its function
would result in failure of a portion of the genome controlling protein
synthesis to be properly expressed. It has been discovered that the genes
coding for protein p120 are particularly useful for this approach.
Inhibition of p120 expression may be useful for the treatment of cancers
and inflammatory diseases. It is also possible that the mechanism of
action of the oligonucleotides of this invention is not related to
interference with mRNA function, either being expressed themselves or
otherwise having an undefined mechanism of action which, nonetheless, is
toxic to the target cells.
Methods of modulating cell proliferation with an effective amount of an
oligonucleotide hybridizable with nucleic acids encoding a proliferation
associated protein are provided. Oligonucleotides hybridizable with
nucleic acids coding for p120 are preferred. It is also preferred that
such oligonucleotides have from about 12 to 50 nucleic acid subunits.
Contacting cells to modulate proliferation with such oligonucleotides
regardless of mechanism is also contemplated hereby.
DETAILED DESCRIPTION OF THE INVENTION
It has been found that certain nucleolar proteins are implicated in
hyperproliferative disease, especially certain cancers. The pleomorphism
and hyperactivity of nucleoli characteristic of malignant cells prompted
studies attempting to identify differences between normal and malignant
nucleoli. Early experiments attempting to identify nucleolar proteins
which were expressed only in malignant cells, utilized rabbits immunized
with nucleoli isolated from malignant cells and preabsorption of the sera
with nucleolar extracts isolated from normal cells Busch, et al., Cancer
Res. 34:2362-2367 (1974); Busch et al., Proc. Soc. Exp. Biol. Med.,
160:185-191 (1979); Davis et al., Proc. Natl. Acad. Sci. U.S.A.,
76:892-896 (1979); Busch et al., Cancer Res., 39:3024-3030 (1979). These
studies resulted in the identification of rabbit antisera which reacted
with a broad range of human cancers but not normal human tissues. The
major problem of this type of an approach was the difficulties associated
with rabbit antibodies in terms of reproducibility between animals,
variable titer and polyclonal nature of the antibodies.
Based upon the initial positive results with polyclonal rabbit antiserum,
efforts were made to purify and characterize tumor specific nucleolar
proteins. Proteins with molecular weights ranging from 54,000 to 68,000
were purified from either rat or human tumors which were not found in the
normal tissues examined. Chan et al., Transplant. Proc., 8:1955-1957
(1981); Chan et al., Cancer Res., 40:3194-3201 (1980); Chan et al., J.
Cancer Res. Clin. Oncol., 103:7-16 (1982); Takahashi et al., Cancer Res.
Clin. Oncol., 105:67-75 (1983). Two-dimensional gel analysis of nucleolar
proteins isolated from malignant and normal tissues also identified
several proteins unique to malignant cells. Spohn et al. Cancer Invest.
3:307-320 (1985).
Because of the lack of reproducibility of polyclonal antiserum, monoclonal
antibodies to human tumor nucleolar antigens were developed. These studies
resulted in the identification of several proteins associated with
proliferating cells but undetected from normal quiescent cells. These
monoclonal antibodies were demonstrated to react with a 145 kDa protein, a
40 kDa protein and a 120 kDa protein Freeman et al., Cancer Res.,
46:3593-3598 (1986); Chatterjee et al., Cancer Res., 47:1123-1129 (1987);
Freeman et al., Cancer Res., 48:1244-1251 (1988). These antigens were
found to be expressed in a similar manner as the cyclins during the G1 to
S phase of the cell cycle as shown by Matthews et al., Nature,
3009:374-376 (1983).
The 120 kDa nucleolar antigen (p120) was of particular interest in that it
was detected in a wide variety of human malignancies but not in most
normal tissues. Further studies suggested that p120 may be a prognostic
marker in breast cancer in that patients with p120 negative tumors had a
good prognosis while patients with p120 positive tumors had a poor
prognosis Freeman et al., Cancer Res., 51:1973-1978 (1991). The p120
antigen is apparently related to the proliferative state of the cell and
nucleolar hyper-reactivity. In support of this conclusion was the finding
that microinjection of p120 antibodies into tumor cells decreases their
proliferative rate and induces a compaction of the nucleolus. Freeman and
Bondada, Am. Assoc. Cancer Res., 31:261 (1990). p120 has, however, also
been identified in small amounts in normal proliferating tissues as shown
by Freeman et al., Cancer Res., 48:1244-1251 (1988).
Multiple overlapping cDNA clones for p120 were isolated and sequenced; the
genomic DNA sequence was also determined. Busch et al., Cancer Res.,
50:4830-4838 (1990); Fonagy et al., Cancer Commun., 1:243-245 (1989);
Larson et al., Cancer Commun., 2:63-71 (1990). Four major domains were
identified in the p120 protein, a basic amino terminal domain, followed by
an acidic domain, a hydrophobic domain, and a domain rich in proline and
cysteine residues. A search of the computer data bases did not reveal any
significant homology between p120 and other known proteins other than an
acidic domain shared by other nucleolar proteins. The gene for p120 was
subsequently demonstrated to be 12 kB in length, composed of 15 exons and
14 introns Larson et al., Cancer Comm., 2:63-71 (1990).
The function of p120 in proliferating cells is currently unknown. The
protein was identified as a component of the nucleolar matrix, associated
with a network of 20 to 30 nm beaded fibrils Ochs et al., Cancer Res.,
48:6523-6529 (1988). Roles suggested for p120 include transcription of
ribosomal RNA or replication of ribosomal DNA or a structural role in the
nucleolar matrix. As exemplified by microinjection of monoclonal
antibodies to p120 Freeman and Bondada, Am. Assoc. Cancer Res., 31:261
(1990), inhibiting p120 expression would decrease proliferation of
malignant cells.
Constructs designed to be antisense to all or a portion of a gene coding
for a nucleolar protein, p120, have been found to inhibit the growth of
human breast carcinoma cells in culture. Saijo, et al., Cancer Letters, in
press. It is believed that other hyperproliferative diseases may be
similarly treated with oligonucleotides designed to be complementary to
genes coding for nucleolar proteins.
Antisense oligonucleotides hold great promise as therapeutic agents for the
treatment of many human diseases. Conceptually, it is much easier to
design compounds which interact with a primary structure such as an RNA
molecule by base pairing than it is to design a molecule to interact with
the active site of an enzyme or ligand binding site of a receptor.
Oligonucleotides specifically bind to the complementary sequence of either
pre-mRNA or mature mRNA, as defined by Watson-Crick base pairing,
inhibiting the flow of genetic information from DNA to protein. The
properties of antisense oligonucleotides which make them specific for
their target sequence also makes them extraordinarily versatile. Because
antisense oligonucleotides are long chains of four monomeric units they
may be readily synthesized for any target RNA sequence. Numerous recent
studies have documented the utility of antisense oligonucleotides as
biochemical tools for studying target proteins. Rothenberg et al., J.
Natl. Cancer Inst., 81:1539-1544 (1989); Zon, G., Pharmaceutical Res.
5:539-549 (1988). Because of recent advances in oligonucleotide chemistry,
synthesis of nuclease resistant oligonucleotides, and oligonucleotide
analogs which exhibit enhanced cellular uptake, it is now possible to
consider the use of antisense oligonucleotides as a form of therapeutics.
Oligonucleotides offer an ideal solution to the problems encountered in
prior art approaches. They can be designed to selectively inhibit the
production of an enzyme, and they avoid non-specific mechanisms such as
free radical scavenging or binding to multiple receptors. A complete
understanding of enzyme mechanism or receptor-ligand interactions is not
needed to design specific inhibitors.
For therapeutics, methods of modulating cell proliferation are provided.
Oligonucleotides designed in accordance with this invention contact
selected cells. Persons of ordinary skill can easily determine optimum
dosages, dosing methodologies and repetition rates. Such treatment is
generally continued until either a cure is effected or a diminution in the
disease state is achieved. Long term treatment is likely for some
diseases.
The formulation of therapeutic compositions and their subsequent
administration is believed to be within the skill in the art. In general,
for therapeutics, a patient suspected of needing such therapy is given an
oligonucleotide in accordance with the invention, commonly in a
pharmaceutically acceptable carrier, in amounts and for periods which will
vary depending upon the nature of the particular disease, its severity and
the patients overall condition. The pharmaceutical compositions of this
invention may be administered in a number of ways depending upon whether
local or systemic treatment is desired, and upon the area to be treated.
Administration may be topically (including ophthalmically, vaginally,
rectally, intranasally), orally, or parenterally, for example by
intravenous drip, subcutaneous, intraperitoneal or intramusular injection.
Formulations for topical administration may include ointments, lotions,
creams, gels, drops, suppositories, sprays, liquids and powders.
Conventional pharmaceutical carriers, aqueous, powder or oily bases,
thickeners and the like may be necessary or desirable. Coated condoms and
the like may also be useful.
Compositions for oral administration include powders or granules,
suspensions or solutions in water or non-aqueous media, capsules, sachets,
or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids
or binders may be desirable.
Formulations for parenteral administration may include sterile aqueous
solutions which may also contain buffers, diluents and other suitable
additives.
Dosing is dependent on severity and responsiveness of the condition to be
treated, but will normally be one or more doses per day, with course of
treatment lasting from several days to several months or until a cure is
effected or a diminution of disease state is achieved. Persons of ordinary
skill can easily determine optimum dosages, dosing methodologies and
repetition rates.
The present invention is also suitable for diagnosing hyperproliferative
states in tissue or other samples from patients suspected of having a
hyperproliferative disease. Thus, the ability of the oligonucleotides of
the present invention to inhibit cell proliferation may be employed to
diagnose such states. A number of assays may be formulated employing the
present invention, which assays will commonly comprise contacting a tissue
sample with an oligonucleotide of the invention under conditions selected
to permit detection and, usually, quantitation of such inhibition.
The oligonucleotides of this invention may also be used for research
purposes. Thus, the specific hybridization exhibited by the
oligonucleotides may be used for assays, purifications, cellular product
productions and in other methodologies which may be appreciated by persons
of ordinary skill in the art.
The present invention employs oligonucleotides designed to be specifically
hybridizable with nucleic acids encoding proliferation associated
proteins. Such oligonucleotides are termed "antisense" since they are
complementary to the "sense" nucleic acids which so encode. In accordance
with this invention, it is not required that such oligonucleotides
actually perform in accordance with an antisense methodology, binding with
and inhibiting mRNA, but only that they be designed to be complementary to
at least a portion of a gene coding a nucleolar protein.
It has now been found that certain oligonucleotides designed to be
antisense to portions of the nucleolar protein p120 DNA are particularly
useful for interfering with cell hyperproliferation. While a number of
such oligonucleotides have been found to have some activity,
oligonucleotides directed to the 3' untranslated region have been found to
have particular activity. Of these, the oligonucleotide sequences:
##STR1##
have demonstrated high activity in inhibiting the growth of a number of
human cancers.
In accordance with the invention, oligonucleotides believed to be useful
are those which are designed to be specifically hybridizable with nucleic
acid coding for all or a portion of a nucleolar protein, especially one
associated with hyperproiiferative disease. The protein p120 is a
particular target. It has also been found that for p120, targeting the 3'
untranslated region of the DNA coding for the protein is particularly
useful, giving rise to the oligonucleotides set forth above.
It is not necessary that oligonucleotides be identical to the ones set
forth with specificity herein. It is sufficient if effective portions of
the oligonucleotides are employed. Preferred oligonucleotides, those
having from 12 to about 50 nucleotide subunits, need not include all
twenty of the subunits of the preferred oligonucleotides. It is sufficient
if an effective portion of the oligonucleotides are incorporated therein.
Accordingly, oligonucleotides which have, for example, twenty-five
subunits, fifteen of which are within the sequences set forth herein, may
have good utility in the practice of certain embodiments of this
invention. Additionally, substitution of one or more subunits within a
sequence may be undertaken without deviating from the spirit of the
invention so long as an effective portion of the oligonucleotide is
retained.
In the context of this invention, the term "oligonucleotide" refers to a
polynucleotide formed from naturally occurring bases and furanosyl groups
joined by native phosphodiester bonds. This term effectively refers to
naturally occurring species or synthetic species formed from naturally
occurring subunits or their close homologs. The term "oligonucleotide" may
also refer to moieties which function similarly to naturally occurring
oligonucleotides but which have non-naturally occurring portions. Thus,
oligonucleotides may have altered sugar moieties or inter-sugar linkages.
Exemplary among these are the phosphorothioate and other sulfur-containing
species which are known for use in the art.
In accordance with certain preferred embodiments, at least some of the
phosphodiester bonds of the oligonucleotide are substituted with a
structure which functions to enhance the ability of the compositions to
penetrate into the region of cells where the RNA whose activity to be
modulated is located. It is preferred that such substitutions comprise
phosphorothioate bonds, methyl phosphonate bonds, or short chain alkyl or
cycloalkyl structures. In accordance with other preferred embodiments, the
phosphodiester bonds are substituted with other structures which are, at
once, substantially non-ionic and non-chiral, or with structures which are
chiral and enantiomerically specific. Persons of ordinary skill in the art
will be able to select other linkages for use in practice of the
invention.
Oligonucleotides may also include species which include at least some
modified base forms. Thus, purines and pyrimidines other than those
normally found in nature may be so employed. Similarly, modifications on
the furanosyl portion of the nucleotide subunits may also be effected, as
long as the essential tenets of this invention are adhered to. Examples of
such modifications are 2'-O-alkyl- and 2'-halogen-subsituted nucleotides.
Some specific examples of modifications at the 2' position of sugar
moieties which are useful in the present invention are OH, SH, SCH.sub.3,
F, OCH.sub.3, OCN, O(CH.sub.2).sub.n NH.sub.2 or O(CH.sub.2).sub.n
CH.sub.3 where n is from 1 to about 10, and other substituents having
similar properties.
Such oligonucleotides are best described as being functionally
interchangeable with natural oligonucleotides (or synthesized
oligonucleotides along natural lines), but which have one or more
differences from natural structure. All such oligonucleotides are
comprehended by this invention so long as they function effectively to
hybridize with the selected RNA. The oligonucleotides in accordance with
this invention preferably comprise from about 12 to about 50 nucleic acid
base units. It is more preferred that such oligonucleotides comprise from
about 12 to 25 nucleic acid base units. As will be appreciated, a nucleic
acid base unit is a base-sugar combination suitably bound to adjacent
nucleic acid base unit through phosphodiester or other bonds.
The oligonucleotides used in accordance with this invention may be
conveniently and routinely made through the well-known technique of solid
phase synthesis. Equipment for such synthesis is sold by several vendors
including Applied Biosystems. Any other means for such synthesis may also
be employed, however the actual synthesis of the oligonucleotides are well
within the talents of the routineer. It is also well known to use similar
techniques to prepare other oligonucleotides such as the phosphorothioates
and alkylated derivatives.
In accordance with this invention, persons of ordinary skill in the art
will understand that messenger RNA includes not only the information to
encode a protein using the three letter genetic code, but also associated
ribonucleotides which form a region known to such persons as the
5'-untranslated region, the 3'-untranslated region, the 5' cap region and
intron/exon junction ribonucleotides. Thus, oligonucleotides may be
formulated in accordance with this invention which are targeted wholly or
in part to these associated ribonucleotides as well as to the
informational ribonucleotides. In preferred embodiments, the
oligonucleotide is specifically hybridizable with a transcription
initiation site, a translation initiation site, a 5' cap region, an
intron/exon junction, coding sequences or sequences in the 5'- or
3'-untranslated region.
In accordance with this invention, the oligonucleotide is specifically
hybridizable with nucleic acids encoding a protein involved in the
proliferation of cells. In preferred embodiments, the protein is p120.
Oligonucleotides comprising the corresponding, specifically hybridizable,
sequence, or part thereof, are useful in the invention.
Several preferred embodiments of this invention are exemplified in
accordance with the following examples. The target mRNA species for
modulation relates to p120. Persons of ordinary skill in the art will
appreciate that the present invention is not so limited, however, and that
it is generally applicable. The inhibition or modulation of production of
the p120 are expected to have significant therapeutic benefits in the
treatment of disease.
The invention is further illustrated in the following, non-limiting
examples.
EXAMPLE 1
Synthesis and Characterization of Oligonucleotides and Analogs
Unmodified DNA oligonucleotides were synthesized on an automated DNA
synthesizer (Applied Biosystems model 380B) using standard phosphoramidite
chemistry with oxidation by iodine. .beta.-cyanoethyldiisopropyl
phosphoramidites were purchased from Applied Biosystems (Foster City,
Calif.). For phosphorothioate oligonucleotides, the standard oxidation
bottle was replaced by a 0.2M solution of H-1,2-benzodithiole-3-one
1,1-dioxide in acetonitrile for the stepwise thiation of the phosphite
linkages. The thiation cycle wait step was increased to 68 seconds and was
followed by the capping step. 2'-O-methyl phosphorothioate
oligonucleotides were synthesized using 2'-O-methyl
.beta.-cyanoethyldiisopropylphosphoramidites (Chemgenes, Needham Mass.)
and the standard cycle for unmodified oligonucleotides, except the wait
step after pulse delivery of tetrazole and base was increased to 360
seconds. The 3'-base used to start the synthesis was a
2'-deoxyribonucleotide. After cleavage from the controlled pore glass
column (Applied Biosystems) and deblocking in concentrated ammonium
hydroxide at 55.degree. C. for 18 hours, the oligonucleotides were
purified by precipitation twice out of 0.5M NaCl with 2.5 volumes ethanol.
Analytical gel electrophoresis was accomplished in 20% acrylamide, 8M
urea, 45 mM Tris-borate buffer, pH 7.0. Oligodeoxynucleotides and their
phosphorothioate analogs were judged from electrophoresis to be greater
than 80% full length material.
The relative amounts of phosphorothioate and phosphodiester linkages
obtained by this synthesis were periodically checked by .sup.31 P NMR
spectroscopy. The spectra were obtained at ambient temperature using
deuterium oxide or dimethyl sulfoxide-d.sub.6 as solvent. Phosphorothioate
samples typically contained less than one percent of phosphodiester
linkages.
For determination of oligonucleotide concentration, OD.sub.260 absorbance
was calculated from the OD units using the equation: OD=E.times.C, where
OD is the absorbance at 260 nm, E is the, mM extinction coefficient for
the entire oligonucleotide, and C is the concentration in mM; Sambrook, et
al., 1989 Molecular Cloning. A Laboratory Manual, Cold Spring Harbor
Laboratory Press: Cold Spring Harbor, 2nd ed. The oligonucleotide
solutions were sterilized by filtration through 0.2 .mu.m cellulose
acetate centrifugal microfilter units (Centrex, Schleicher & Schuell) by
centrifugation at 1500 g for 10 minutes at 4.degree. C. The concentrations
of oligodeoxynucleotides were determined after filtration as described
above: the concentrations were adjusted to 100 .mu.M and the solutions
were kept at 4.degree. C. Oligonucleotides having the sequences shown in
Table 1 were made.
TABLE I
______________________________________
SEQ ID NO:
SEQUENCE (IDENT. NO.)
REGION
______________________________________
AAAGCCCCCC ACCAC 1 Coding
CCCCATGGTA CTGTGGCAGG
2 AUG Codon
GGAGAAGGTG GCGTCGCGCG
3 5' UTR
CCTTCCTCCC GCTGAGCCCC
4 Coding
CGGTCAAAGC CCCCCACCAC
5 Coding
TCCCAGTCCC ACCTCCCATC
6 3' UTR
AAGCGGCAAA GGCAGCACCC
7 3' UTR
CGGTCAAAGC CCCCCACCAC
8 Coding
CACCCGCCTT GGCCTCCCAC
9 3' UTR
GGGATTCACA GGCATGAGCC
10 3' UTR
CGCCACCACA CCCGGCTGAT
11 3' UTR
TCTCGAACAC CTGACCTCAG
12 3' UTR
CAAAAATACT CAGTGGCCAG
13 Stop Codon
CACCCGCCTT GGCCTCCCAG
14 3' UTR
CACGCCTCCC GACTCTGCCC
15 Randomized
GTGGGAGGCC AAGGCGGGTG
16 sense
______________________________________
EXAMPLE 2
Cell Lines
HeLa S3 (ATCC CCL 2.2, human epithelioid cervix carcinoma) cells were
subcultured in Dulbecco's modified Eagle Medium (D-MEM) (GIBCO BRL),
supplemented with 10% fetal bovine serum (FBS) (GIBCO BRL) and 1%
penicillin-streptomycin liquid (100 000 IU/ml penicillin G sodium, 10
mg/ml streptomycin sulfate in 0.85% saline) (GIBCO BRL). LOX (IMVI, human
amelanotic melanoma) cells (provided by Dr. D. J. Dykes, Southern Research
Institute, Birmingham, Ala.) were subcultured in RPMI 1640 medium (RPMI)
(GIBCO BRL) supplemented with 10% FBS and 1% penicillin-streptomycin
liquid. HRCC-SN12A1 (human renal cell carcinoma) cells (established from
the ascitic cells of intrarenally transplanted HRCC-bearing nude mouse and
provided by Dr. I. J. Fidler, M.D., Anderson Cancer Center, Houston,
Tex.)(Naito, etal., 1986) were subcultured in Eagle minimum essential
medium (MEM) (GIBCO BRL), supplemented with 10% FBS, vitamins,
L-glutamine, sodium pyruvate, non-essential amino acids and 1%
penicillin-streptomycin liquid. All cells were negative for mycoplasma
infection as determined by a DNA stain (McGarrity, Methods in Enzymology:
Cell Culture, Vol 63, p23 (Academic Press, San Diego; 1979); Freshney,
Culture of Animal Cells: A Manual of Basic Techniques (Wiley-Liss, NY;
1987).
EXAMPLE 3
Treatment of Cells
Twenty-four hours after plating (1.times.10.sup.5 cells into 6-well cell
culture dishes), the cells growing in monolayer were gently washed once
with 5 ml serum-free D-MEM, RPMI and MEM medium for HeLa S3, LOX and
HRCC-SN12A1 cells, respectively. Freshly prepared serum-free
mediumcontaining 10 .mu.g/ml cationic lipid (DOTMA); Chiang, et al., J.
Biol. Chem., 266:18162 (1991); Bennett, et al., J. Liposome Research, in
press (1992); were mixed with oligonucleotide and preincubated at
37.degree. C. in a humidified incubator for 15 minutes to allow formation
of an oligonucleotide-cationic lipid complex. The oligonucleotide
concentrations were between 0.001 and 10 .mu.M, but for the majority of
the experiments for HeLa S3 cells 0.1 .mu.M, for LOX cells 0.03-0.05-0.1
.mu.M, and for HRCC cells 0.1 .mu.M concentrations were used. After 4 hour
incubation (treatment time) at 37.degree. C. in a humidified CO.sub.2
incubator, the medium was changed to complete medium containing 10% FBS
and 1% penicillin-streptomycin liquid. The cells were cultured at
37.degree. C. in a humidified CO.sub.2 incubator for 7 days.
EXAMPLE 4
Determination of Cell Growth
The effect of oligonucleotides on cell growth was determined by counting
the attached cells in the 6-well plates through a phase contrast inverted
microscope (Nikon Diaphot, 10.times.objective, 10.times.ocular,
4.times.magnification extender, total magnification: 400.times.). The
attached cells on 10 randomly chosen fields were counted (10-200
cells/field) and the total cell number was calculated by multiplying the
mean cell number by the correction factor (f.sub.6-well =6028,
f.sub.24-well =1258, f.sub.10 cm dish =35,670). The cell number
determination was calibrated and standardized in several experiments. The
dead floating cells (viability was determined by colony formation) were
not counted. The cell number in each well was determined before treatment,
immediately after treatment, and daily after treatment for 5-7 days.
EXAMPLE 5
Screening of Oligonucleotides for Ability to Inhibit the Production of p120
In order to assess the effectiveness of the oligonucleotides, assays were
performed. In parallel experiments, exponentially growing HeLa cells in
monolayer were treated with antisense oligonucleotides designed to
hybridize to various regions of the p120 sequence; Fonagy, et al., Cancer
Communications, 1:243 (1989); Larson, et al., Cancer Communications, 2:63
(1990) (Table 1). The oligonucleotides were complexed with cationic lipid
(0.1 .mu.M oligonucleotide+10 .mu.g/ml DOTMA in serum-free medium for 4
hours (FIG. 1A) or used alone in serum-free medium (FIG. 1B). Cell growth
was monitored as described in Example 4. For plots (Sigmaplot), and for
data analysis (Epistat), software packages were used.
FIG. 1A shows representative growth curves of HeLa cells in the presence of
DOTMA and/or oligonucleotides. Inhibition of cell growth was found with
several p120 antisense oligonucleotides. The most consistent and greatest
inhibition of cell growth was observed with the oligonucleotide having SEQ
ID NO: 9 (FIG. 1A, filled circles), which was then used in subsequent
experiments. Immediately after treatment, there was no cell detachment or
direct cell killing, but 24-48 hours later a cytocidal effect was
observed. The rates of cell growth inhibition and the percentage of
surviving cells differed with individual oligonucleotides (FIG. 1A).
No cytostatic or cytocidal effects were observed with the oligonucleotide
alone at concentrations of 0.1-1 .mu.M; in the absence of cationic lipid
(24 h in serum-containing medium) (FIG. 1B), the growth rates of the
oligonucleotide-treated cells and cells treated with DOTMA alone were the
same. Inhibition of cell growth after DOTMA-mediated oligonucleotide
treatment in complete (10% FBS) medium was very slight compared to the
serum-free condition (FIG. 1C). In the serum-free medium DOTMA was
essential for the growth inhibition by oligonucleotide having SEQ ID NO:
9.
In some preliminary experiments, the 4 hour DOTMA-mediated oligonucleotide
treatment in serum-free medium was found to be optimal. Extending the time
in complete 10% FBS-containing medium for 20 or 60 hours; Bennett, et al.,
Molecular Pharmacology, in press, and Bennett, et al., J. Liposome
Research, in press (1992); had no additional effect. Accordingly, the
cells were incubated with the oligonucleotide-DOTMA complex for 4 hours in
serum-free medium.
Two of the oligonucleotides, SEQ ID NO: 9 and SEQ ID NO: 14 were found to
have inhibitory activity. These oligonucleotides, which were designed to
be complementary to the 3' untranslated region of p120, were tested
further as described in Example 6. Others of the oligonucleotides were
also found to have some activity (data not shown).
EXAMPLE 6
Oligonucleotide Screening of Preferred Embodiments
Screening of antisense oligonucleotides for human tumor cell growth
inhibition was conducted for SEQ ID NO: 9 and SEQ ID NO: 14. The data are
shown in FIG. 2, panels A, B, and C. Panel A shows the results for HeLa
(human epitheloid cervix carcinoma) cells while Panel B depicts LOX (human
amelanotic melanoma metastasis) cells. Panel C relates data for SN12A1
(human renal cell carcinoma) cells. All testing protocols are conventional
and generally similar to the protocol set forth in Example 4.
Exponentially growing human tumor cells in monolayers, were treated with
0.1 and 1 .mu.M oligonucleotide+10 .mu.g/ml DOTMA ("Lipofectin" reagent)
for 4 hours. Marked cell growth inhibition and 0.5 to 1.5 log-cell kill
was observed, especially 3-4 days after treatment with SEQ ID NO: 9. Each
of the preferred oligonucleotides showed marked inhibition of the tumors
in the respective panels. Use of DOTMA appears to be useful in adjunct
with the oligonucleotides.
In a second set of experiments, the effect of oligonucleotide SEQ ID NO: 9
was analyzed on LOX (FIG. 3A) and HRCC-SN12A1 (FIG. 3B) cells. In this
comparative study, two days after treatment, oligonucleotide SEQ ID NO: 9
produced a 1.2 and 0.7 log cell kill on LOX and SN12A1 cells respectively.
The maximum cytocidal effect (1.3 log cell kill) on SN12A1 cells was at 4
days after treatment. All cell types recovered after the treatment nadir
(FIG. 3). The relationship of concentration of oligonucleotide SEQ ID NO:
9 to inhibition of cell growth for the HeLa and LOX cells is shown in FIG.
4. The IC.sub.50 values were 0.02 .mu.M for HeLa cells and 0.01 .mu.M for
LOX cells (FIG. 4).
FIG. 5 shows the effect of repeated treatment of antisense oligonucleotide
SEQ ID NO: 9 in the presence of DOTMA on HeLa (FIG. 5A) and LOX (FIG. 5B)
cells. The cells were treated once for 4 h day 1 after seeding (filled
circles) or with two 4 h treatments on days 1 and 3 (open circles). The
oligonucleotide concentrations were 0.1 .mu.M for HeLa cells and 0.05
.mu.M for LOX cells. Repeated treatment had additive effects on HeLa
cells: after the nadir, the cells recovered. Repeated treatment of LOX
cells was more inhibitory than for HeLa cells; a single treatment produced
a 1.4 log cell kill of LOX cells. Repeated treatment killed most LOX cells
and no recovery was found on day 8.
EXAMPLE 7
Comparison of Oligonucleotides
For analysis of their relative effects on cell growth, oligonucleotide p120
antisense oligodeoxynucleotide-phosphorothioates having sequences as set
forth in SEQ ID NO: 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, and 13 were screened
using 0.1-0.5 .mu.M oligonucleotide and 10 .mu.g/ml DOTMA in serum-free
medium for 4 h. After initial screening (data not shown), the
oligonucleotides chosen for further studies had 50% inhibition of cell
growth: SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 9 (Table
1). The greatest cell growth inhibitory effects (FIG. 1A) were found with
oligonucleotides SEQ ID NO: 9 (87.6.+-.11.3%; .+-.SD, n=22 experiment) and
SEQ ID NO: 6 (70.7.+-.24.8%; .+-.SD, n=12 experiment). The cell growth
inhibitory effect of oligonucleotide SEQ ID NO: 9 was significantly
greater than that of oligonucleotide SEQ ID NO: 6 (P<0.02).
To confirm the specificity of the biological effects of the antisense
oligonucleotide SEQ ID NO: 9 on HeLa cells, its effects were compared to a
sense oligonucleotide SEQ ID NO: 16 (the sequence of which is
complementary to oligonucleotide SEQ ID NO: 9, or the random sequence
oligonucleotide SEQ ID NO: 15 (the nucleotide composition is that of
oligonucleotide SEQ ID NO: 9; but the sequence was randomized) (Table 1,
FIG. 6). A 0.2 log HeLa cell kill was observed with the random sequence
SEQ ID NO: 15 compared to a 0.7 log HeLa cell kill with antisense
oligonucleotide SEQ ID NO: 9, 2 days after treatment. No inhibitory effect
was found with the sense oligonucleotide SEQ ID NO: 16.
EXAMPLE 8
Pharmacology of p120 Antisense Oligonucleotide Phosphorothioates
Phosphorothioate oligonucleotide SEQ ID NO: 9 was labeled with
[.gamma..sup.32 P]ATP by T4 polynucleotide kinass to analyze cellular
uptake, efflux and stability in the presence or absence of DOTMA. The
cellular uptake had a plateau after 1 hour treatment. 5-15 fold more of
oligonucleotide SEQ ID NO: 9 was associated with the cells in the presence
of DOTMA than in its absence. 60% of the oligonucleotide localized to the
nuclei after 4 hours treatment in the presence of DOTMA, approximately 50%
remained in the cells 20 hours post-treatment. The stability of
phosphorothioate oligonucleotides was much greater than the phosphodiester
oligonucleotides. Only 40% degradation of the phosphorothioate
oligonucleotide was found after 24 hours in 10% serum-containing medium.
More than 50% of the phosphodiester oligonucleotide was degraded within 1
hour. DOTMA enhanced the activity of antisense oligonucleotide
phosphorothioate.
EXAMPLE 9
In Vivo Studies in Nude Mice
Intraperitoneally (i.p.) transplanted, exponentially growing LOX ascites
tumor cells were harvested from nude mice, washed and resuspended in
serum-free RPMI medium. A total of 2.times.10.sup.6 viable cells
(determined by trypan blue exclusion) in 0.5 ml RPMI medium were injected
i.p. into the homozygous mutant, HSd: Athymic Nude-nu male mice (Sambrook,
et al., 1989). Treatment was started 1 day after the i.p. injection of
tumor cells and the oligonucleotide in the presence of DOTMA was given
i.p. on days 1, 3 and 5. Tumor growth was followed by daily inspection of
the animals. The experiments were terminated when the ascite tumors were
visible both in controls and treated animals, generally by day 14. All
animal experimentation followed the guidelines of the Baylor College of
Medicine and New York Academy of Sciences.
EXAMPLE 10
Tumor Growth Inhibition of Oligonucleotide SEQ ID NO: 9 in vivo
The tumor growth inhibitory effect of antisense oligonucleotide SEQ ID NO:
9 was studied on i.p. injected LOX tumor cells. FIG. 7 shows the
dose-response curves of treatment on days 1, 3 and 5 with oligonucleotide
SEQ ID NO: 9 alone without DOTMA (open circles) or with oligonucleotide
SEQ ID NO: 9 complexed with DOTMA (filled circles). No tumor growth
inhibition or other toxic effects occurred after treatment with PBS alone
or DOTMA in PBS (1-10 mg/kg bodyweight). Oligonucleotide SEQ ID NO: 9
complexed with DOTMA inhibited cell growth in vivo by 80% with the 0.65
mg/kg bodyweight dose and by 90% with 6.5 mg/kg bodyweight; the IC.sub.50
was 0.26 mg/kg bodyweight.
EXAMPLE 11
Nuclear Aberrations in Human Tumor Cells Following Treatment with Antisense
Oligonucleotiae SEQ ID NO: 9
HeLa and LOX human tumor cell lines were analyzed by light and fluorescence
microscopy after 4 hours treatment with 0.2 or 0.4 .mu.M antisense (SEQ ID
NO: 9) or sense (SEQ ID NO: 16) oligonucleotide with DOTMA. Staining with
methylene blue (RNA), anti-p120 monoclonal antibody (p120), or Hoeschst
dye 33258 (DNA) showed mitotic cells decreased by 50% at 4 hours and 70%
at 8 to 72 hours post-treatment. Nucleolar unraveling and fragmentation
and chromatin alterations were observed. In some LOX cells chromatin was
condensed as in prophase arrest. In HeLa cells, chromatin was condensed
and compacted. Decreased mitoses correlated with decreased .sup.3
H-thymidine incorporation. Cell growth decreased 70-80%.
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 16
(2) INFORMATION FOR SEQ ID NO: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(iv) ANTI-SENSE: yes
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:
AAAGCCCCCCACCAC15
(2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: Nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(iv) ANTI-SENSE: yes
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:
CCCCATGGTACTGTGGCAGG20
(2) INFORMATION FOR SEQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(iv) ANTI-SENSE: yes
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:
GGAGAAGGTGGCGTCGCGCG20
(2) INFORMATION FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(iv) ANTI-SENSE: yes
(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:
CCTTCCTCCCGCTGAGCCCC20
(2) INFORMATION FOR SEQ ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20
| | |
