|
Description  |
|
|
BACKGROUND OF THE INVENTION
1. Technical Field
This invention relates to a method for detecting individuals who are
predisposed to obesity. This invention further relates to genetic
techniques for detecting a low density lipoprotein receptor gene (LDLR)
microsatellite polymorphism.
2. Background
Obesity is a common nutritional disorder that affects approximately 30% of
adults in the Western world. Obesity is a multifactorial condition in
which both environmental and genetic factors are important determinants in
susceptibility to body fat accumulation (Despres et al., 1992, Molecular
and Cellular Biochemistry, 113, 151-169). Adoption studies have implicated
genetic control, rather than childhood environment, as the main influence
on the development of adult obesity (Sorensen, T. I. & Stunkard, A. J.,
1993, Acta Psychiatrica Scandinavica, 370, 67-72). Obesity, essential
hypertension, impaired glucose tolerance, non-insulin-dependent diabetes
mellitus and dyslipidaemia tend to cluster in families. Collectively,
these abnormalities constitute the multiple metabolic syndrome or Syndrome
X, which is associated with cardiovascular disease (Kesaniemi et. al.,
1992, Annals of Medicine (Helsinki), 24, 461-464).
Lipida and cholesterol ingested in an individuals' diet are essential for
body maintenance. These molecules are transported through the body in
lipoproteins. There are four types of lipoproteins each responsible for
transporting varying amounts of lipid and cholesterol. It has been shown
that lipoprotein concentration in the blood is proportional to abdominal
fat disposition in obese individuals (Nishina et al., 1992, Proceeding of
the National Academy of Science U.S.A., 89, 708-712). The low density
lipoprotein (LDL) receptor is responsible for regulating LDL levels and
hence cholesterol and plasma lipids in the blood. The gene encoding the
LDL receptor (LDLR) is located at chromosome 19 position p13.2.
LDLR is approximately 45 kb in length and contains 18 exons (Sudhof et al.,
1985, Science, 228, 815-822). The ApaLI LDLR polymorphism detects a
nucleotide substitution in intron 15 of this gene.
Studies of the ApaLI restriction fragment length polymorphism (RFLP) of
LDLR showed an association with obesity in essential hypertensives.
However, no association was shown between the ApaLI RFLP and hypertension
(Zee et al., 1992, Biochemical Biophysical Research Communications, 189,
965-971). In a further study with a population of 70 normotensives, the
ApaLI polymorphism did not show a significant association with obesity
(Morris et al., 1994, Clinical Science, 86, 583-592). Similarly, a HincII
LDLR polymorphism which detects a substitution in exon 12 showed a
significant association with obesity in essential hypertensives but not in
normotensives (Zee et al., 1995, Clinical Genetics, 47, 118-121). Both of
these polymorphisms are located towards the 5' end of the gene.
There appears to be no reports associating obesity in normotensives with
the LDLR gene. Furthermore, there is no known test of identifying such
individuals who may be predisposed to obesity. If these individuals were
aware that they were predisposed to obesity, they could be treated or
follow dietary programs to prevent the onset of an obesity problem or
treat an existing obesity problem.
SUMMARY OF THE INVENTION
The present invention results from the surprising discovery that a LDLR
microsatellite marker located towards the 3' end of the gene showed a
significant association with obesity in a mixed population of lean and
obese individuals. The LDLR microsatellite marker is located in exon 18
and is a dinucleotide AT tandem repeat region. Individuals who had an AT
tandem repeat number of 7 in exon 18 of the LDLE gene on both chromosomes
had a statistical predisposition to being lean. Hence, individuals who did
not have an AT tandem repeat of 7 in exon 18 of the LDLR gene on one
chromosome had a statistical predisposition to obesity.
Thus, it is an object of the present invention to provide a method for
detecting whether an individual may be predisposed to obesity. Further,
individuals who had a tandem repeat of 8 or 10 in exon 18 of the LDLR gene
On one chromosome and a tandem repeat of 8 or 10 in exon 18 of the LDLR
gene on the other chromosome had a statistical predisposition to obesity.
In one aspect, the invention resides in a method for detecting whether an
individual is disposed to obesity including the steps of:
(i) obtaining a sample containing human genomic DNA from said individual;
and
(ii) detecting whether said genomic DNA in said sample has a 7 AT tandem
repeat in exon 18 of the low density lipoprotein receptor gene on one or
both chromosomes, wherein the absence of the 7 AT tandem repeat indicates
said individual is predisposed to obesity, lean being defined as having a
body mass index less than 26 kg/m.sup.2 and obese being defined as having
a body mass index equal to or greater than 26 kg/m.sup.2.
The presence of the 7 AT tandem repeat in exon 18 of the LDLR gene
indicates said individual is predisposed to being lean.
The sample may be any suitable tissue or body fluid. These samples are
preferably blood containing leukocyte(s).
The detecting of the AT tandem repeats preferably involves PCR
amplification using suitable primers. The choice of primers will determine
the size of the FCR product and hence the manner of distinguishing and
identifying products. Preferably the primers disclosed in Zuliani and
Hobbs et al., 1990, Nucleic Acids Research, 18, 4300 are used. These
primers are also shown in FIG. 1. After PCR amplification the amplified
products may be determined by sequence analysis or by size separation.
Size separation is preferably achieved by electrophoresis of the PCR
products in a suitable agarose or polyacylamide gel.
The number of tandem repeats in exon 18 of the LDLR gene may vary. Where an
individual has a genotype with 7 tandem repeats in the LDLR gene on both
chromosomes, or 7 tandem repeats in the LDLR gene on one chromosome and 8
or 10 tandem repeats in the LDLR gene on the other chromosome, then the
individual has a predisposition to being lean. Where an individual has a
genotype with 8 tandem repeats in the LDLR gene on both chromosomes, 10
tandem repeats in the LDLR gene on both chromosomes, or 8 tandem repeats
in the LDLR gene on one chromosome and 10 tandem repeats in the LDLR gene
on the other chromosome, then the individual has a predisposition to
obesity.
In summary, the following results of the method can be achieved:
(i) 7/7 (AT tandem repeat number in exon of the LDLR gene on one
chromosome/AT tandem repeat number in exon 18 of the LDLR gene on the
other chromosome) indicates the individual is predisposed to being lean;
(ii) 7/8 (AT tandem repeat number in exon 18 of the LDLR gene on one
chromosome/AT tandem repeat number in exon 18 of the LDLR gene on the
other chromosome) indicates the individual is predisposed to being lean;
(iii) 7/10 (AT tandem repeat number in exon 18 of the LDLE gene on one
chromosome/AT tandem repeat number in exon 18 of the LDLR gene on the
other chromosome) indicates the individual is predisposed to being lean;
(iv) 8/8 (AT tandem repeat number in exon 18 of the LDLR gene on One
chromosome/AT tandem repeat number in exon 18 of the LDLR gene on the
other chromosome) indicates the individual is predisposed to obesity;
(v) 8/10 (AT tandem repeat number in exon 18 of the LDLR gene on one
chromosome/AT tandem repeat number in exon 18 of the LDLR gene on the
other chromosome) indicates the individual is predisposed to obesity; and
(vi) 10/10 (AT tandem repeat number in exon 18 of the LDLE gene on one
chromosome/AT tandem repeat number in exon 18 of the LDLR gene on the
other chromosome) indicates the individual is predisposed to obesity.
Support for the determinations of whether an individual is predisposed to
being lean or obese is provided in the statistical analysis of the results
shown in Examples 2 and 3.
The results of this method also appears to be independent of whether an
individual is hypertensive or normotensive. Therefore, the method can be
used for hypertensive and normotensive individuals.
Reference may now be made to various preferred embodiments of the
invention. Example 1 is a preferred embodiment of the method of the
present invention. Examples 2 and 3 are examples of the use of the method
and provide supporting evidence for the method. The preferred embodiments
are described by way of example only.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts the sequences of two DNA primers for PCR amplification of
the AT tandem repeat region on exon 18 in the LDLR gene.
FIG. 2 is a graph depicting Genescan results showing a 106 base pair
homozygote for the LDLR AT repeat microsatellite marker. The allele sizes
arising for an individual are compared to internal lane standards.
FIG. 3 is also a graph depicting Genescan results showing a 108 bp
homozygote for the LDLR AT repeat microsatellite marker.
FIG. 4 is another graph depicting Genescan results showing a 108/112 bp
heterozygote for the LDLR AT repeat microsatellite marker.
FIG. 5 is yet another graph depicting Genescan results showing a 112/112 bp
homozygote for the LDLR AT repeat microsatellite marker.
EXAMPLE 1
The preferred method of determining whether an individual is predisposed to
obesity is described below.
A sample of 20 to 40 mls of blood was extracted from individuals. The
sample was centrifuged at 3800 rpm for 10 minutes to separate the blood
cells from the serum. The serum was stored at -70.degree. C.
DNA was extracted from isolated blood cells using an adapted salting out
method (Miller et al., 1988, Nucleic Acids Research, 16, 1215). To 10 mls
of blood, NKM (140 mM NaCl, 30 mM KCl, 3 mM MgCl.sub.2) was mixed to give
a final volume of 25 mL and vigorously shaken for 10 seconds to lyse the
cells. After centrifugation at 4800 rpm for 25 minutes, the cell pellet
was washed with 25 mL RSB (10 mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM
MgCl.sub.2). The mixture was centrifuged at 4000 rpm with 15 minutes and
the pellet was resuspended in 1 ml of RSB followed by the addition of 4 mL
of lympholysis buffer (1% SDS, 50 mM Tris-HCl, pH 7.5, 50 mM EDTA, 0.15 mM
NaCl) and 0.5 mg/mL of proteinase K. The mixture was incubated overnight
at 37.degree. C. in a shaking water bath. After the incubation, 2 mL of a
saturated NaCl solution was added and the mixture shaken vigorously for 15
seconds. The proteins were removed by centrifuging for 15 minutes at 2500
rpm. Following the addition of a further 2 mL of saturated NaCl solution
to the supernatant and centrifugation at 2500 rpm for minutes, two volumes
of absolute ethanol were added to the supernatant and inverted to mix. The
clump of precipitated DNA was removed using a disposable inoculation loop
and placed in 2 mL of TE buffer and heated at 37.degree. C. for 2 hours to
dissolve the DNA.
The LDLR dinucleotiae AT repeat polymorphism was amplified using primers,
GZ-7 and GZ-8 (FIG. 1), in the Polymerase Chain Reaction (PCR). The PCR
amplification involved final concentrations of 200 .mu.M deoxynucleotides
(dATP, dCTP, dGTP and dTTP), 1.75 mM MgCl.sub.2, 5 .mu.l of 10 times
buffer (500 mM KCl, 100 mM Tris-HCl, pH 9.0, 1% Triton) and 1.2 units of
Taq Polymerase together and adding an aliquot to 150 ng purified DNA in a
thin walled PCR tube under a biohazard flow hood. The cycling conditions
for the PCR amplification were an initial 94.degree. C. denaturing period
of four minutes, followed by 35 cycles of 94.degree. C. for 40 seconds;
60.degree. C. for 9 seconds and a final extension period of 72.degree. C.
for 120 seconds).
Detection of PCR products involved electrophoresis on a 6% polyacrylamide
denaturing gel and analysis using the Applied Biosystems 373 DNA sequencer
with Genescan software. Using laser technology to excite the LDLR
microsatellite primers, the allele sizes were determined by comparison to
fluorescent internal lane standards. Genescan eletrophoretograms and
spreadsheets were used to identify genotypes and to determine allele
frequencies.
The following results were achievable:
(i) Where only a 106 bp PCR product was detected and identified, it was
held that the individual was predisposed to being lean. A 106 bp PCR
product represents a 7 tandem repeat in exon 18 of the LDLR gene.
(ii) Where a 106 bp PCR product and a 108 bp PCR product were detected and
identified, it was held that the individual was predisposed to being lean.
A 108 bp PCR product represents an 8 tandem repeat in exon 18 of the LDLR
gene.
(iii) Where a 106 bp PCR product and a 112 bp PCR product were detected and
identified, it was held that the individual was predisposed to being lean.
A 112 bp PCR product represents a 10 tandem repeat in exon 18 of the LDLR
gene.
(iv) Where only a 108 bp PCR product was detected and identified, it was
held that the individual was predisposed to obesity.
(v) Where a 108 bp PCR product and a 112 bp PCR product were detected and
identified, it was held that the individual was predisposed to obesity.
(vi) Where only a 112 bp PCR product was detected and identified, it was
held that individual was predisposed to obesity.
EXAMPLE 2
METHODS:
Subjects
Twenty millilitre blood samples were collected from normotensives for the
present cross-sectional association study. Individuals were classified as
normotensive if their blood pressure was less than 140/90 mmHg, they were
not on hypertensive medication and they had no family history of
hypertension, diabetes or heart disease. The population was divided into
lean and obese categories on the basis of body mass index (BMI); obese
individuals had a BMI of .gtoreq.26 kg/m.sup.2 and individuals were
classified as lean if they had a BMI of <26 kg/m.sup.2.
Polymerase chain reaction analysis
DNA was extracted from white blood cells as previously described (Zee, R.
Y. L. et al., 1992, supra) and alleles for an LDLR dinucleotide repeat
polymorphism were determined using fluorescently labelled primers (FIG. 1)
and polymerase chain reaction (PCR) amplification. Polymerase chain
reactions were performed as described previously (Zuliani, G. & Hobbs, H.
H., 1990, supra), but modified to use a 94.degree. C. initial denaturing
step for 3 minutes followed by 35 cycles of denaturation for 40s at
94.degree. C., annealing and extension at 60.degree. C. for 1 minute and a
final extension for 2 minutes at 72.degree. C. Polymerase chain reaction
products were fractionated on 6% polyacrylamide denaturing gels and
alleles were determined by comparison to size standards using an Applied
Biosystems DNA sequencer with Genescan software (Perkin-Elmer), as
described by Ziegle et al., 1992, Genomics, 14, 1026-1031.
Analysis of data
Electrophoretograms and spreadsheets were used to determine the genotypes
for each subject tested. The total for each genotype was tabulated and
allele frequencies calculated. Differences in frequencies were tested by
Chi-squared analysis with two degrees of freedom.
RESULTS
Genotypes for the LDLR dinucleotide tandem repeat were determined for 83
normotensives, 33 of whom were obese and 50 lean. The polymorphic repeat
marker has been localised to exon 18 of LDLR. Polymerase chain reaction
amplification using the GZ-7 and GZ-8 LDLR oligonucleotide primers detects
three DNA fragments, 106, 108, and 112 bp, containing 7, 8, and 10 (TA)
repeats, respectively (Zuliani, G. & Hobbs, H. H., 1990, supra). Genotypes
were determined after fractionation of amplified, fluorescently labelled
PCR products on polyacrylamide denaturing gels and comparison of fragment
sizes to labelled standards using Genescan software. The total number of
alleles was determined from genotype results and statistical analysis
performed (Table 1). Statistical analysis of these results indicated that
there was a significant difference between the lean and obese groups of
normotensives (X.sup.2 =9.8; p=0.008).
EXAMPLE 3
METHODS
Subjects
Categorising obese subjects required a body mass index of 26 kg/m.sup.2 or
greater whilst lean subjects required a body mass index less than 26
kg/m.sup.2. Individuals were excluded from the study if they had a family
history of diabetes or thyroid disease. These conditions were determined
by a detailed questionnaire on each of the 92 obese and 158 lean
consenting subjects. If individuals satisfied the criteria, 40 mL of blood
was extracted from the antecubital fossa of each non-fasting subject and
placed in a lithium heparin tube.
Lipid Analysis
Blood being used in the study was transported on ice to the laboratory. The
blood sample was centrifuged at 3800 rpm for 10 minutes to separate the
blood cells from the serum which was stored at -70.degree. C. The serum
was analysed for total cholesterol, high density lipoprotein cholesterol
(HDL-cholesterol) and triglyceride.
Cholesterol was analysed on a BM Hitachi 747-200 analyser using the
CHOD-PAP enzymatic colorimetric method (Siedel et al., 1983, Clin. Chem,
29, 1075). HDL-cholesterol was precipitated with polyethylene glycol.
Triglyceride was assayed on the same analyser using the GPO-PAP enzymatic
colorimetric method (Wahlefeld, A. W., 1974, Methods of enzymatic
analysis, 2nd edition, p 1831. Verlag Chemie Weinheim and Academic Press,
Inc. New York).
Genetic Analysis
DNA Extraction
DNA was extracted from isolated blood cells using an adapted salting out
method (Miller et al., 1988, supra). To 10 ml of blood, NKM (140 mM NaCl,
30 mM KCl, 3 mM MgCl.sub.2) was mixed to give a final volume of 25 mL and
vigorously shaken for 10 seconds to lyse the cells. After centrifugation
at 4800 rpm for 25 minutes, the cell pellet was washed with 25 mL RSB (10
mM Tris-HCl, pH 7.5, 10 mM NaCl, 3 mM MgCl.sub.2). The mixture was
centrifuged at 4000 rpm with 15 minutes and the pellet was resuspended in
1 ml of RSB followed by the addition of 4 mL of lympholysis buffer (1%
SDS, 50 mM Tris-HCl, pH 7.5, 50 mM EDTA, 0.15 mM NaCl) and 0.5 mg/mL of
proteinase K. The mixture was incubated overnight at 37.degree. C. in a
shaking water bath. After the incubation, 2 mL of a saturated NaCl
solution was added and the mixture shaken vigorously for 15 seconds. The
proteins were removed by centrifuging for 15 minutes at 2500 rpm.
Following the addition of a further 2 mL of saturated NaCl solution to the
supernatant and centrifugation at 2500 rpm for 15 minutes, two volumes of
absolute ethanol were added to the supernatant and inverted to mix. The
clump of precipitated DNA was removed using a disposable inoculation loop
and placed in 2 mL of TE buffer and heated at 37.degree. C. for 2 hours to
dissolve the DNA.
PCR amplification
The LDLR dinucleotide AT repeat polymorphism was amplified using primers,
GZ-7 and GZ-8 (FIG. 1), in the Polymerase Chain Reaction (PCR). The PCR
amplification involved final concentrations of 200 .mu.M deoxynucleotides
(dATP, dCTP, dGTP and dTTP), 1.75 mM MgCl.sub.2, 5 .mu.l of 10 times
buffer (500 mM KCl, 100 mM Tris-HCl, pH 9.0, 1% Triton) and 1.2 units of
Taq Polymerase together and adding an aliquot to 150 ng purified DNA in a
thin walled PCR tube under a biohazard flow hood. The cycling conditions
for the PCR amplification were an initial 94.degree. C. denaturing period
of four minutes, followed by 35 cycles of 94.degree. C. for 40 seconds;
60.degree. C. for 9 seconds and a final extension period of 72.degree. C.
for 120 seconds).
Detection of PCR products involved electrophoresis on a 6% polyacrylamide
denaturing gel and analysis using the Applied Biosystems 373 DNA sequencer
with Genescan Software. Using laser technology to excite the LDLR
microsatellite primers, the allele sizes were determined by comparison to
fluorescent internal lane standards. Genescan cletrophoretograms and
spreadsheets were used to identify genotypes and to determine allele
frequencies.
Statistical Analysis
Differences in total cholesterol, triglyceride, HDL-cholesterol,
LDL-cholesterol and VLDL-cholesterol parameters as compared to body mass
index and genotype were determined by one-way analysis of variance
(ANOVA). Chi-squared analysis was used to determine any differences
between the allele frequencies in the obese and lean subjects.
RESULTS
Following the PCR amplifications of the labelled primers that detect the
LDLR dinucleotide AT repeat polymorphism, the ABI DNA sequencer with
Genescan software was used to identify fragment sizes. Genescan analysis
on the PCR fragments resulted in detection of three alleles of 106 bp, 108
bp and 112 bp. A combination of these alleles results in homozygote
genotypes, as shown in FIG. 2 (106/106 bp), FIG. 3 (108 bp), FIG. 5
(112/112 bp) and heterozygote genotypes as shown in FIG. 4 (108/112 pb).
The results of a study on 92 obese subjects with a body mass index equal to
or greater than 26 kg/m.sup.2 and with 158 lean subjects with a body mass
index less than 26 kg/m.sup.2 are illustrated in Table 2. Chi-squared
analysis on the total allele counts revealed a highly significant
difference (X.sup.2 =7.09, P=0.0298) between the lean and obese groups.
Furthermore, genotypes were investigated to determine the allele
combinations that determine an obese BMI (Table 2). Genotypic analysis
indicated that individuals with the 106 bp allele were more likely to be
lean than individuals possessing 108 bp or 112 bp alleles.
The results of the one-way anova study comparing the relationship between
the plasma lipid concentrations and BMI (Table 3) revealed a significant
difference between total cholesterol, triglyceride, HDL-cholesterol,
LDL-cholesterol and VLDL-cholesterol concentration. An association can
therefore be drawn between obesity and high concentrations for total
cholesterol, triglyceride and triglyceride carrying LDL-cholesterol and
VLDL-cholesterol lipoproteins whereas obese individuals have a lower
HDL-cholesterol concentration.
It has been found that the results of the method of determining whether an
individual is predisposed to obesity is independent of hypertension. Of
the population tested in this study, 73 were hypertensive (34 lean, 39
obese) and 175 were normotensive (128 lean, 47 obese). When the
hypertensives were removed from the analysis and only normotensives tested
for significant differences between lean and obese populations, the LDLR
microsatellite marker still showed a strongly significant association with
obesity (X.sup.2 6.07; P=0.048). Hence the association of this marker with
obesity is independent of hypertension.
DISCUSSION
Results from this study indicated a significant association X.sup.2 =7.09,
P=0.029) between the LDLR microsatellite marker located towards the 3' end
of the gene and obesity. ANOVA analysis between the lean and obese
individuals illustrated that the obese individuals have higher
cholesterol, triglyceride and LDL-cholesterol levels which may arise from
an impaired LDL receptor regulation and lower HDL-cholesterol levels than
lean individuals. The association of LDLR and obesity appears to be
related to the importance of the 106 bp allele.
ANOVA analysis on actual BMI values for each genotype revealed the 106 bp
allele increases an individuals' chance of being lean. Mean values
obtained for BMI indicated that the 106 bp homozygote is associated with a
lean BMI. This phenomena appears to be a result of a 106 bp allele
dominance.
In this study, a significant association (X.sup.2 =7.09, P=0.0298) between
an LDLR microsatellite marker, located towards the 3' end of the gene, and
BMI was shown from a cross-sectional analysis study in a general
population comprised of obese and lean individuals. These results together
with the ANOVA results confirm that there is an association between an
LDLR microsatellite and obesity indicating that this gene may play an
important role in obesity predisposition.
TABLE 1
______________________________________
Association analysis of a low density
lipoprotein receptor dinucleotide repeat
polymorphism in obese and lean normotensives
Allele frequencies (bp)
Total alleles (bp)*
NT NO. 106 108 112 106 108 112
______________________________________
Obese 33 0.60 0.20 0.20 40 13 13
Lean 50 0.78 0.17 0.05 78 17 5
______________________________________
*x.sup.2 = 9.8; P = 0.008
TABLE 2
__________________________________________________________________________
Chi-squared anaylsis on allele numbers in
lean and obese subjects
Genotype Frequency
106/
106/
106/
108/
108/
112/
Allele Number (bp)*
n 106
108 112
108 112
112 106
108 112
__________________________________________________________________________
Obese
92 0.33
0.12
0.34
0.01
0.08
0.12
104
20 60
Lean
158 0.44
0.12
0.37
0.01
0.03
0.03
216
26 74
__________________________________________________________________________
*x.sup.2 = 7.09; P = 0.029
TABLE 3
______________________________________
Results of ANOVA analysis on plasma lipid
parameters for the obese and lean subjects
Statistical
BMI Analysis
Obese Lean ANOVA
______________________________________
n 53 71
Total cholesterol
6.2421 +/- 1.09
5.79 +/- 1.02
0.0202
Triglyceride
2.13 +/- 1.11 1.70 +/- 1.12
0.0351
HDL-cholesterol
1.38 +/- 0.42 1.66 +/- 0.57
0.0025
LDL-cholesterol
3.93 +/- 1.09 3.38 +/- 0.97
0.0056
VLDL-cholesterol
0.93 +/- 0.41 0.70 +/- 0.49
0.0310
______________________________________
__________________________________________________________________________
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 2
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
CACTTTGTATATTGGTTGAAACTGT25
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: single
(D) TOPOLOGY: linear
(ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
CACTGAACAAATACAGCAACCAGGG25
__________________________________________________________________________
* * * * *
|
|
|
|
|
Description  |
|