The present invention is related to oligonucleotides for the specific identification of Staphylococci species which nucleotide sequence has between 15 and 350 base pairs, preferably between 15 and 45 base pairs, obtained from the “consensus” femA nucleotide sequence (CNS) of FIG. 3 or its complementary strand. The present invention is also related to a method and a diagnostic device using said oligonucleotide for the identification of various types of Staphylococci species strains.
1. An isolated and purified nucleotide sequence corresponding to SEQ ID NO:1, homologues or parts thereof.
2. An isolated and purified nucleotide sequence according to claim 1, wherein said homologues comprise SEQ ID NOs: 40, 42, 44, 46, 48, 50, 52 and 54.
3. An isolated and purified nucleotide sequence according to claim 2, wherein said homologues have more than 85% homology to SEQ ID NOs: 40, 42, 44, 46, 48, 50, 52 and 54.
4. An isolated and purified nucleotide sequence according to claim 2, wherein said homologues have more than 90% homology to SEQ ID NOs: 40, 42, 44, 46, 48, 50, 52 and 54.
5. An isolated and purified nucleotide sequence according to claim 1, wherein said parts of SEQ ID NO:1 are nucleotide sequences having between 25 and 350 bp, which have more than 60% homology to SEQ ID NO:1.
6. An isolated and purified nucleotide sequence according to claim 1, wherein said parts of SEQ ID NO:1 are nucleotide sequences having between 25 and 250 bp, which have more than 60% homology to SEQ ID NO:1.
7. An isolated and purified nucleotide sequence according to claim 1, wherein said parts of SEQ ID NO:1 are nucleotide sequences having between 25 and 45 bp, which have more than 60% homology to SEQ ID NO:1.
8. An isolated and purified nucleotide sequence according to claim 1, wherein said parts of SEQ ID NO:1 comprise SEQ ID NOS: 2-28, 56-64.
9. An isolated and purified nucleotide sequence according to claim 1, wherein said parts of SEQ ID NO:1 comprise SEQ ID NOS: 65-83.
10. Use of an isolated and purified nucleotide sequence corresponding to SEQ ID NO:1, homologues or parts thereof for the identification of at least two Staphylococci species.
11. Diagnostic device for the identification of at least two Staphylococci species comprising at least one oligonucleotide which has more than 60% homology to SEQ ID NO:1 and at least one isolated or purified oligonucleotides which has less than 50% homology to SEQ ID NO:1.
Description
[0001] This patent application is a continuation-in-part (CIP) of U.S. Ser. No. 09/509,234, filed Sep. 25, 2000, the contents of all of which are incorporated by reference into the present application.
FIELD OF THE INVENTION
[0002] The present invention refers to new genetic sequences, diagnostic and/or quantification methods and devices using said sequences for the identification of various types of Staphylococci strains as well as the therapeutical aspects of said genetic sequences.
BACKGROUND OF THE INVENTION
[0003] Increasing incidence of nosocomial infections by multiresistant bacteria (even to antibiotics like vancomycin) is a world-wide concern. Methicillin-resistant coagulase-negative Staphylococci (MR-CNS) and S. aureus (MRSA) express a high level cross-resistance to all .beta.-lactam antibiotics (Ryffel et al. (1990), Refsahl et al. (1992)). They have an additional low-affinity penicillin-building protein, PBP2a (PBP2′), encoded by the mecA gene. The mecA determinant is found in all multiresistant staphylococcal species (Chackbart et al. (1989), Suzuki et al. (1992), Vannuffel et al. (1995)) and is highly conserved among the different species (Ryffel et al. (1990)).
[0004] Several other chromosomal sites, in which transposon inactivation reduces the level of .beta.-lactam resistance, have been identified in S. aureus (SA) (Hiramatsu (1992), Berger-Bachi et al. (1992), de Lancastre et al. (1994)). The appropriate functioning of these regulator genes rather than the quantity of PBP2a determines the minimal inhibitory concentration value and homogeneous expression of resistance of staphylococcal isolates (Ryffel et al. (1994), de Lancastre et al. (1994)).
[0005] The femA-femB operon, initially identified in S. aureus, is one of those genetic factors essential for methicillin resistance (Berger-Bchi et al. (1989)). It is involved in the formation of the characteristic pentaglycine side chain of the SA peptidoglycan (Stranden et al. (1997)). Unlike other regulatory genes, femA was shown to retain a strong conservation over time in clinical isolates of MRSA, hence confirming its key role in cell wall metabolism and methicillin resistance (Hurlimann-Dalel et al. (1992)). In contrast to mecA, femA-femB is present both in the genome of resistant and susceptible SA strains (Unal et al. (1992), Vannuffel et al. (1995)).
[0006] Often, identification of the Staphylococci is limited to a rapid screening test for S. aureus, and non-S. aureus isolates are simply reported as coagulase-negative Staphylococci. In fact, these bacteria isolates include a variety of species and many different strains (Kleeman et al. (1993)). There is little epidemiological information related to the acquisition and spread of these organisms. This is potentially due to the lack of an easy and accurate way to identify species and to provide clinically timely informations.
[0007] Several molecular assays designed for detecting femA in SA failed to amplify an homologous sequence in coagulase-negative Staphylococci (Kizaki et al. (1994), Vannuffel et al. (1995)). Nevertheless, low-stringency heterologous hybridisation analysis suggested the presence of such a structurally related gene in S. epidermidis (SE) (Unal et al. (1992)).
[0008] These data were followed by complete identification and sequence analysis of the femA and femB open reading frames in S. epidermidis (Albom et al. (1996)). Intra- and interspecies relatedness of these genes and conservation of genomic organisation are therefore consistent with gene duplication of one of these genes in an ancestral organism and the possibility of femA phylogenetic conservation in all staphylococcal species (Alborn et al. (1996)).
[0009] The complete genetic sequence of the femA gene de S. epidermidis, the protein encoded by the femA gene (FemA) and vectors and micro-organisms comprising genes encoding the FemA protein are described in the U.S. Pat. No. 5,587,307.
[0010] Aims of the Invention
[0011] The present invention aims to provide new genetic sequences, methods and devices for the improvement of the identification and/or the quantification of various types of Staphylococci strains through their femA-like determinants, which allow by a rapid screening their epidemiological study.
[0012] Another aim of the invention is to identify similar genetic sequences which may exist in known or not known Staphylococci species or other gram-positive bacterial strains.
[0013] A last aim of the present invention is to provide new sequences encoding femA proteins of Staphylococci species, their femA proteins, vector(s) comprising said nucleotide sequences and cell (s) transformed by said vector(s) for possible therapeutical applications.
SUMMARY OF THE INVENTION
[0014] The Inventors have identified new DNA and amino acid sequences from new strains of Staphylococcus hominis, Staphylococcus saprophyticus and Staphylococcus haemolyticus. Said new nucleotide sequences allow an alignment of these new sequences with the femA gene from Staphylococci previously described (S. aureus, S. epidermidis and S. saprophyticus). By the alignment of more than 2 sequences, preferably more than 4 sequences, the Inventors have identified for the first time a consensus femA sequence useful for molecular genotyping of different Staphylococci species which was not possible previously, when only few femA sequences of Staphylococci strains were known.
[0015] Therefore, a first aspect of the present invention is related to the “consensus” nucleotide sequence as represented in the enclosed FIG. 3. With said “consensus” nucleotide sequence, the Inventors were able to provide oligonucleotides (such as primers or probes) which can be used for the genetic amplification, the identification and/or quantification of various femA sequences which are specific of known or unknown Staphylococci species.
[0016] The femA sequence is known to be involved with the biosynthesis of glycin-containing cross-bridges of the peptidoglycan and the peptidoglycan organisation is also known to be well conserved among various Staphylococci species and possibly among other gram-positive bacteria.
[0017] Therefore, it is also possible to use the new “consensus” femA sequence and said new oligonucleotides extrapolated from the alignment of the sequences presented in FIG. 3, for the molecular genotyping of other Staphylococci species and possibly other gram-positive bacteria. It is also known that the femA sequence is similar to the femB sequence. Therefore, these oligonucleotides could also be used for the molecular genotyping of femB genes of different Staphylococci species or other gram-positive bacteria.
[0018] Another aspect of the present invention concerns the possible therapeutical uses of new femA nucleotide sequences isolated from the strains S. hominis, S. saprophyticus, S. haemolyticus, S. lugdunensis, S. xylosus, S. capitis, S. schleiferi and S. sciuri having a nucleotide or amino acid sequence which presents more than 85%, preferably more than 90% homology or 100% homology with the genetic sequences presented in the FIGS. 6 to 13, their complementary strand and functional variants thereof. Functional variants of said amino acid sequences are peptides which contain one or more modifications to the primary amino acids sequence and retain the activity of the complete and wild type femA molecule. Variants of the peptide are obtained by nucleotidic sequences which differ from the above-identified described sequences by a degeneration of their genetic code or are sequences which hybridise with said sequences or their complementary strand, preferably under stringent conditions such as the ones described in the document Sambrook et al., .sctn..sctn. 9.47-9.51 in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0019] A further aspect of the present invention concerns the recombinant vector (i.e. constructions into which the sequence of the invention may be inserted for transport in different genetic environments and for expression in a host cell, such as a phagemide, a virus, a plasmid, a cationic vesicle, a liposome, etc.) comprising said nucleotide sequences and their complementary strands, or the corresponding RNA sequences, possibly linked to one or more regulatory sequences or markers (resistance to antibiotics, enzyme coding sequences, . . . ) active into a cell.
[0020] Similarly, the nucleic acid sequence according to the invention may be obtained by synthetic methodology well known by the person skilled in the art, such as the one described by Brown et al. (“Method of Enzymology”, Acad. Press, New-York, No. 68 pp. 109-151 (1979)) or by conventional DNA synthesising apparatus such as the applied biosystem model 380A or 380B DNA synthesiser.
[0021] Other aspects of the present invention concern the recombinant host (prokaryotic) cell transformed by said vector and the purified (possibly recombinant) proteins or peptides encoded by said nucleic acid sequences, possibly linked to a carrier molecule such as BSA and obtained by said cells. Said recombinant proteins or peptides could be obtained by genetic engineering or could be obtained by synthesis (see U.S. Pat. No. 5,587,307 incorporated herein by reference) and may comprise residues enhancing their stability (resistance to hydrolysis by proteases, etc.) such as the one described by Nachman et al. (Regul. Pept. Vol. 57, pp. 359-370 (1995)).
[0022] A preferred vector for expression in a E. coli host cell is derived from the E. coli plasmid pET-11A available from Novagen Inc. (Catalogue No. 69436-A). The transformation technique used with the above-identified vector has been described in the U.S. Pat. No. 5,587,307.
[0023] A further aspect of the present invention concerns the inhibitor (used to possibly treat (with addition of antibiotics) antibiotics resistance bacteria) directed against said proteins, peptides or nucleic acid molecules. Advantageously, said inhibitor is a antibody, preferably a monoclonal antibody, or an antisense nucleotide molecule, such as a ribozyme, which could be present in a vector in order to block the expression of said femA nucleotide sequences.
[0024] A last aspect of the present invention concerns the pharmaceutical composition, preferably a vaccine, against Staphylococci infections in an animal, including a human, comprising a pharmaceutically acceptable carrier and a sufficient amount of an active compound selected from the group consisting of said nucleic acid molecules, vectors, recombinant host cells transformed by said vector(s), inhibitors (directed against said proteins, peptides or nucleic acid molecules) and a mixture thereof.
[0025] Another aspect of the present invention concerns oligonucleotides which are (DNA) sequences having between 15 and 350 base pairs, preferably between 17 and 250 base pairs (such as primers or probes) obtained from the consensus sequence of FIG. 3 or its complementary strand. Preferably, said oligonucleotides are primers having between 15 and 45 base pairs, more preferably between 17 and 25 base pairs.
[0026] According to a first embodiment of the present invention, said oligonucleotide is a primer having between 15 and 45 base pairs, which presents more than 60%, advantageously more than 70%, preferably more than 80%, more specifically more than 90% homology with (fragments of) the “consensus” femA nucleotide sequence (CNS) identified in the FIG. 3.
[0027] Therefore, the oligonucleotides according to the invention are new sequences or preferred fragments of known sequences of S. aureus, S. epidermidis or S. simulans but not the complete wild type known femA nucleotide sequence.
[0028] Preferably, the oligonucleotide according to the invention is selected from the group consisting of the following nucleotide sequences:
[0029] ANAATGAANTTTACNAATTTNACNGCNANAGANTT (SEQ ID NO: 2) and more particularly femS1 TAATGAAGTTTACAAAATTT (SEQ ID NO: 3) or femS2 TAATGAAGTTTACNAAATTT (SEQ ID NO: 4)
[0030] ATGNCNNANAGNCATTTNACNCANA (SEQ ID NO: 5) and more particularly femU1 (“universal” sequence sense of the multiplex PCR): TGCCATATAGTCATTTACGC (SEQ ID NO: 6)
[0031] TAGTNGGNATNAANAANAANNATAANGANGTNATTGC (SEQ ID NO: 7)
[0032] GTNCCNGTNATGAAANTNTTNAANTANTTTTATTC (SEQ ID NO: 8)
[0033] AATGCNGGNNANGATTGG (SEQ ID NO: 9)
[0034] GNAANNGNAANACNAAAAAAGTNNANAANAATGGNGTNAAAGT (SEQ ID NO: 10) and more particularly fsq1S (et 1AS): AAAAAGTTCAAAAAATGG (SEQ ID NO: 11) and fsq2S (and 2AS): AAAAAGTACAAAAAATGG (SEQ ID NO: 12)
[0035] AAGANGANNTNCCNATNTTNNGNTCATTNATGGANGATAC (SEQ ID NO: 13)
[0036] TATATNNANTTTGATGANTA (SEQ ID NO: 14)
[0037] AANGANATNGANAAANGNCCNGANAANAAAAA (SEQ ID NO: 15) and more particularly fsq3S (and 3AS): AAAGATATTGAAAAACGA (SEQ ID NO: 16), fsq4S (and 4AS): AAAGATATTGAAAAGAGACC (SEQ ID NO: 17), fsq5S (and 5AS): AAAGATATCGAGAAAGAC (SEQ ID NO: 18) and fsq6S (and 6AS) AAAGACATCGACAAGCGT (SEQ ID NO: 19).
[0038] ANCATGGNAANGAATTACCNAT (SEQ ID NO: 20) and more particularly fem1 (primer for the production of a probe and of marked amplicons for reverse hybridisation experiment): GAACATGGTAATGAATTAC (SEQ ID NO: 21)
[0039] AATCCNTNTGAAGTNGTNTANTANGCNGGTGG (SEQ ID NO: 22)
[0040] AGNTATGCNNTNCAATGGNNNATGATTAANTATGC (SEQ ID NO: 23)
[0041] TTTANNGANGANGCNGAAGATGNNGGNGTNNTNAANTTNAAAAA (SEQ ID NO: 24) and more particularly fem3bio (primer for the production of a probe and of marked amplicons for reverse hybridization experiment): TTTACTGAAGATGCTGAAGA (SEQ ID NO: 25)
[0042] GTTGGNGANTTNNTNAAACC (SEQ ID NO: 26) and more particularly fem2 (primer for the production of a probe and of marked amplicons for reverse hybridisation experiment): GTTGGTGACTTTATTAAACC (SEQ ID NO: 27)
[0043] ATGAAATTTACAGAGTTAA (=femAS1) (SEQ ID NO: 28).
[0044] In addition, the following universal primer may also be used in the present invention: GCCATACAGTCATTTCACGC (=uni) (SEQ ID NO: 65).
[0045] Said primer(s) will be designated hereafter as “universal primer(s)”.
[0046] A further aspect of the present invention concerns the oligonucleotide being either a primer or a probe as above-described, having between 15 and 350 base pairs, preferably between 17 and 250 base pairs, or a primer having between 15 and 45 base pairs, more preferably between 17 and 25 base pairs, which will be designated hereafter as “specific primer(s)”, having a nucleotide sequence which presents less than 50%, advantageously less than 40%, preferably less than 30%, more specifically less than 20% homology with (fragments of) the “consensus” femA nucleotide sequence (CNS) identified in the FIG. 3 and with another femA nucleotide sequence specific for other Staphylococci strains.
[0047] Advantageously, said “specific primer” is selected from the group consisting of the following nucleotide sequences:
1 ACAGCAGATGACATCATT (SEQ ID NO: 29) TAATGAAAGAAATGTGCTTA (SEQ ID NO: 30) ACACAACTTCAATTAGAAC (SEQ ID NO: 31) AGTATTAGCAAATGCGG (SEQ ID NO: 32) ATGCATATTTTCCGTAA (SEQ ID NO: 33) CAGCAGATGACATCATT (SEQ ID NO: 34) CATCTAAAGATATATTAAATGGA (SEQ ID NO: 35) AGTATTAGCAAATGCGGGTCAC (SEQ ID NO: 36) CAACACAACTTCAATTAGAA (SEQ ID NO: 37)
[0048] In addition, the following specific femA primers can be used in a multiplex protocol for staphylococcal differential diagnosis:
2 CAGCAGATGACATCATTA (SEQ ID NO: 66) for identification of S. aureus, AACCGAAACGAAAGAATT (SEQ ID NO: 67) for identification of S. haemolyticus, and CAACACAACTTCAATTAGAAC (SEQ ID NO: 68) for identification of S. hominis.
[0049] Further, the following primers or probes can be used for each of the following staphylococcal species, in the method or kit according to the present invention for the identification and/or quantification of a Staphylococci species, which may present resistance to antibiotics and which is present in a sample:
3 S. aureus sbs. anaerobius: ATTTAAAATATCACGCTCTTCGTTTAG, (SEQ ID NO:69) S. epidermidis: ATTAAGCACATTTCTTTCATTATTTAG, (SEQ ID NO:70) S. haemolyticus: ATTTAAAGTTTCACGTTCATTTTGTAA, (SEQ ID NO:71) S. hominis: ATTTAATGTCTGACGTTCTGCATGAAG, (SEQ ID NO:72) S. saprophyticus: ACTTAATACTTCGCGTTCAGCCTT- TAA, (SEQ ID NO:73) S. capitis: ATTAAGAACATCTCTTTCATTATTAA- G, (SEQ ID NO:74) S. cohnii sbs. urealyticum: ACTTAACACTTCACGCTCTGACTTGAG, (SEQ ID NO:75) S. gallinarum: ACTTAAAACTTCACGTTCAGCAGTAAG, (SEQ ID NO:76) S. intermedius: GTGGAAATCTTGCTCTTCAGATTTCAG, (SEQ ID NO:77) S. lugdunensis: TTCTAAAGTTTGTCGTTCATTCGTTAG, (SEQ ID NO:78) S. schielferi: TTTAAAGTCTTGCGCTTCAGTGTTGAG, (SEQ ID NO:79) S. sciuri: GTTGTATTGTTCATGTTCTTTTTCTAA, (SEQ ID NO:80) S. simulans: TTCTAAATTCTTTTGTTCAGCGTTCAA, (SEQ ID NO:81) S. warneri: AGTTAAGGTTTCTTTTTCATTATTGAG, (SEQ ID NO:82) S. xylosus: GCTTAACACCTCACGTTGAGCTTGCAA. (SEQ ID NO:83)
[0050] The oligonucleotides according to the invention are selected according to their physiochemical properties in order to avoid cross-hybridisation between themselves. Said primers are not complementary to each other and they contain a similar percentage of bases GC.
[0051] Said oligonucleotides are used in an identification and/or quantification method of one or more Staphylococcus species and possibly other gram-positive bacteria. In a preferred embodiment, said oligonucleotides are used in an identification and/or quantification method of at least two different Staphylococcus species and possibly other gram-positive bacteria.
[0052] Therefore, another aspect of the present invention is related to an identification and/or quantification method of a Staphylococci species which may present resistance to one or more antibiotic(s), and is possibly combined with a method for the identification of a resistance to antibiotics, especially .beta.-lactam antibiotics, (for instance through the identification of a variant of the mecA gene as described by Vannuffel et al. (1998)).
[0053] In another embodiment, the present invention is related to an identification and/or quantification method of at least two different Staphylococci species. The diagnostic device for the identification of at least two Staphylococci species comprises preferably at least one oligonucleotide which has more than 60% homology to SEQ ID NO:1 and at least one isolated or purified oligonucleotides which has less than 50% homology to SEQ ID NO:1.
[0054] The method for the detection, the identification and/or the quantification of a bacteria, preferably a staphylococcal species, comprises the steps of:
[0055] obtaining a nucleotide sequence from said bacteria present in a sample, preferably a biological body sample obtained from a patient such as blood, serum, dialyse liquid or cerebrospinal liquid, or from any other bacteriological growth medium,
[0056] possibly purifying said nucleotide sequence from possible contaminants,
[0057] possibly amplifying by known genetic amplification techniques said nucleotide sequence with one or more universal oligonucleotide(s) (universal primer(s)) according to the invention, and
[0058] identifying the specific gram-positive bacteria species, preferably the specific Staphylocossi species:
[0059] by a comparative measure of the length of the (possibly amplified) nucleotide sequence or
[0060] by reverse hybridisation of the (possibly amplified) nucleotide sequence with one or more specific oligonucleotide(s) (specific probe(s) or primer(s)) according to the invention which are specific of said bacteria, said oligonucleotide(s) being preferably immobilised on a solid support.
[0061] The comparative measure of the length of a possibly amplified nucleotide sequences can be performed by the analysis of their migration (compared with a known ladder) upon an electrophoresis gel.
[0062] Preferably, the genetic amplification technique is selected from the group consisting of PCR (U.S. Pat. No. 4,965,188), LCR (Landgren et al., Sciences, 241, pp. 1077-1080 (1988)), NASBA (Kievits et al., J. Virol. Methods, 35, pp. 273-286 (1991)), CPR (patent WO95/14106) or ICR.
[0063] The specific detection of the possibly amplified nucleotide sequences can be obtained by the person skilled in the art by using known specific gel electrophoresis techniques, in situ hybridisation, hybridisation on solid support, in solution, on dot blot, by Northern blot or Southern blot hybridisation, etc.
[0064] Advantageously, the probes which are specific of the bacteria are immobilised on a solid support according to the method described in the international patent application WO98/11253 incorporated herein by reference.
[0065] Said specific oligonucleotides (probes or “elongated” primers) have a length comprised between 50 and 350 base pairs, preferably between 120 and 250 base pairs, and are fixed to the solid support by a terminal 5′ phosphate upon an amine function of the solid support by carbodiimide reaction (as described in the document WO98/11253 incorporated herein by reference).
[0066] The solid support can be selected from the group consisting of cellulose or nylon filters, plastic supports such as 96-well microtiter plates, microbeads, preferably magnetic microbeads, or any other support suitable for the fixation of a nucleotide sequence.
[0067] The method according to the invention can be advantageously combined with another specific detection step of a possible resistance to antibiotics, especially .beta.-lactam antibiotics (for instance through the identification by the above-described technique of variants of the mecA gene as described by Vannuffel et al. (1998)).
[0068] The present invention concerns also a diagnostic and/or quantification device or kit for the identification and/or the quantification of a Staphylococcus species or other gram-positive bacteria, comprising the oligonucleotides according to the invention and possibly all the media necessary for the identification of a (possibly amplified) nucleotide sequence of said bacteria through any one of the above-described methods. In another embodiment, the present invention concerns also a diagnostic and/or quantification device or kit for the identification and/or the quantification of at least two different Staphylococcus species or other gram-positive bacteria, comprising the oligonucleotides according to the invention and possibly all the media necessary for the identification of a (possibly amplified) nucleotide sequence of said bacteria through any one of the above-described methods.
[0069] Advantageously, the method and device according to the invention are adapted for the quantification of said Staphylococci strains by the use of a “internal or external standard sequence”, preferably the one described in the patent application WO98/11253 incorporated herein by reference.
[0070] Therefore, according to a first embodiment of the present invention, the nucleic acid sequence from a Staphylococcus species, for instance Staphylococcus aureus, is amplified by a “universal primer” and by a “specific primer” which is specific for S. aureus. The identification of S. aureus will be obtained upon an agarose electrophoresis gel wherein the amplified nucleotide sequence (shorter than the amplified nucleotide sequence of another Staphylococci species such as S. epidermidis) and identified by the use of a comparative ladder.
[0071] According to another embodiment of the present invention, a Staphylococcus species (such as S. aureus) is identified by reverse hybridisation of the amplified nucleotide sequence with a probe which is specific of said bacteria and which is immobilised on a solid support such as filter.
[0072] The present invention will be described in details in the following non-limiting examples, in reference to the Figures described hereafter.
SHORT DESCRIPTION OF THE DRAWINGS
[0073] The FIG. 1 represents 5 partially overlapping fragments of the femA genes from S. hominis, S. saprophyticus and S. haemolyticus obtained by PCR amplification.
[0074] The FIGS. 2a & b represent the alignment of the nucleotide sequences of femA genes from S. hominis, S. saprophyticus, S. aureus, S. epidermidis and S. haemolyticus.
[0075] The FIG. 3 represents the consensus sequence according to the invention.
[0076] The FIG. 4 represents the result of differential diagnosis between different strains of Staphylococci by reverse hybridisation.
[0077] The FIG. 5 represents amplification of CNS species under universal conditions.
[0078] The FIGS. 6a & b represent the complete femA wild type genetic sequence of the strain S. haemolyticus.
[0079] The FIGS. 7a & b represent the complete femA wild type genetic sequence of the strain S. lugdunensis.
[0080] The FIGS. 8a & b represent the complete femA wild type genetic sequence of the strain S. xylosus.
[0081] The FIGS. 9a & b represent the complete femA wild type genetic sequence of the strain S. capitas.
[0082] The FIG. 10a & b represent the complete femA wild type genetic sequence of the strain S. schleiferi.
[0083] The FIGS. 11a & b represent the complete femA wild type genetic sequence of the strain S. sciuri.
[0084] The FIG. 12 represents the complete femA wild type genetic sequence of the strain S. hominis.
[0085] The FIG. 13 represents the complete femA wild type genetic sequence of the strain S. saprophyticus.
EXAMPLES
Example 1
Sequencing Strategy
[0086] Fragments of the femA genes from S. hominis and S. saprophyticus have been obtained by PCR amplification, in low stringency annealing conditions. Primers used for amplification are matching the potentially conserved regions and have been designed according to sequences homologies between S. aureus, S. sapropyticus and S. epidermidis femA nucleotide sequences. For both S. hominis and S. saprophyticus species, 5 partially overlapping fragments have been synthesised allowing the sequencing of the entire femA genes (FIG. 1).
Example 2
Identification of a Consensus Sequence
[0087] Alignment of the nucleotide sequences of femA genes from S. hominis and S. saprophyticus as well as with femA genes sequenced to date from S. aureus (GenBank accession number M23918), S. epidermidis (GenBank accession number U23713) and S. haemolyticus is presented in FIG. 3 and has allowed to propose a “consensus” femA nucleotide sequence (CNS) whose genomic organisation displays highly conserved regions flanked by variable ones. On this basis, interspecies phylogenetic variations could be exploited to design genotyping strategies for species-specific identification of Staphylococci. The “consensus” sequence is therefore a powerful molecular tool for specific diagnostic of staphylococcal infections.
Example 3
Sequencing of other Staphylococcal femA Genes
[0088] The consensus sequence can be exploited for designing universal primers allowing the production, under permissive annealing conditions, of overlapping PCR products whose sequencing will identify the entire femA sequence.
Example 4
Differential Diagnosis between S. aureus. S. epidermidis, S. hominis and S. saprophyticus by Reverse Hybridisation
[0089] The Inventors have set up a reverse hybridisation assay for rapid and combined identification of the most clinically relevant Staphylococci species, and their mecA status. Two sets of primers, chosen in a conserved domain of the consensus sequence (bioU1-bioU3 and fem1-fem3bio), amplifying a 286 and bio-220 bp fragments, respectively) were synthesised. Species-specificity of femA amplicons was insured by the genomic variability between the conserved regions. FemA probes were immobilised on nylon strips. Hybridisation was performed with biotinylated femA PCR fragments from the strain of interest. The strategy was first assessed with ATCC strains (S. aureus, S. epidermidis, S. hominis and S. saprophyticus) (FIG. 4). Specificity was identified by standard methods. Accuracy was 100% for species identification.
Example 5
Differential Diagnosis between Staphylococcal Species
[0090] This assay is able to identify any staphylococcal species if following requirements are fulfilled:
[0091] primers fem1, fem2 and fem3bio are universal for Staphylococci;
[0092] there is a wide enough phylogenetic variation between any CNS species to promote a specific hybridisation.
[0093] The first requirement is fulfilled for, i.e., S. haemolyticus, S. capitis, S. cohnii, S. xylosus, S. simulans, S. lugdunensis, S. schleiferi and S. warneri strains (FIG. 5).
Example 6
Multiplex Amplification of femA and mecA Genetic Determinants for a Molecular Diagnosis of a Specific Staphylococcal Infection
[0094] A total of 48 patients treated in 4 contiguous intensive cares units were included in the study. Endotracheal aspirates (ETA) were collected from the patients and submitted to the multiplex PCR analysis according to the technique described by Vannuffel et al. (1995). Clinical specimens were homogenised in 5 ml of TE buffer (20 mM TRIS HCl, pH 8.0, 10 mM EDTA) containing 2% (w/v) SDS.
[0095] The homogenate (1.5 ml) was then centrifuged for 5 minutes at 7500.times.g. The cellular pellet was washed once with TE buffer lysed in the presence of 1% (v/v) Triton X-100 and 50 .mu.g of lysostaphin (Sigma) and incubated for 15 minutes at 37.degree. C. Lysis was completed by adding 100 .mu.g of proteinase K (Boehringer). The lysate was incubated for another 5 minutes at 55 .degree. C. and 5 minutes at 95.degree. C., and centrifuged at 4000.times.g for 5 minutes.
[0096] In order to purify bacterial DNA, 200 .mu.l of supernatant were then filtered on a Macherey-Nagel Nucleospin C+T.RTM. column and eluted with 200 .mu.l sterile H2O. Two different amounts of DNA suspension (2 .mu.l and 200 .mu.l) were submitted to multiplex PCR amplification with the primers 5′-TGGCTATCGTGTCACAATCG-3′ (SEQ ID NO: 38)and 5′-CTGGAACTTGTTGAGCAGAG-3′ (SEQ ID NO: 39) for mecA and the above-described primers for femA, yielding different fragments.
[0097] femA and mecA signals were found in specimens containing either susceptible S. aureus (n=10) and methycillin-resistant coagulase-negative Staphylococci (n=6) respectively. On the other hand, no signal was obtained from ETA gram-negative bacteria (n=5) as well as MS-CNS (n=6) and from 5 ETA containing normal pharyngeal flora.
[0098] This multiplex PCR strategy for detecting Staphylococci in ETA was completed in less than 6 hours either on the day of the samples’ collection. This is an advantage with respect to the time required to conventional identification and susceptibility tests (48 to 72 hours).
Example 7
Amplification, Cloning and Sequencing of other femA Genes
[0099] Two primers were selected among the conserved parts of the consensus sequence for the amplification of the femA gene.
[0100] These primers are femS1, femS2 and femAS1 (anti-sense primer). ADN from strains of Staphylococcus hominis, saprophyticus, haemolyticus, lugdunensis, schleiferi, sciuri, xylosus, simulans, capitis, gallinarum, cohnii and wameri were amplified from said primers and amplification fragments were cloned in the vector pCR.RTM.-XLTOPO and introduced by electroporation in E. coli cells TOP10 (TOPO XL PCR Cloning Kit.RTM., Invitrogen, Carlsbad, Calif.).
[0101] Amplified fragments of strain S. lugdunensis, schleiferi, sciuri, xylosus, and capitis were sequenced by Taq Dye Deoxy Terminator Cycle.RTM. sequencing on a ABI 277 DNA sequencer.RTM. (PE Applied Biosystems, Foster City, Calif.) by the following primers:
[0102] femS1 or femS2 or femAS1
[0103] fsq1S and fsq1AS
[0104] fsq2S and fsq2AS
[0105] fsq3S and fsq3AS
[0106] fsq4S and fsq4AS
[0107] fsq5S and fsq5AS
[0108] fsq6S and fsq6AS
References
[0109] 1. Alborn W. E. Jr et al., Gene 180: 177-81 (1996)
[0110] 2. Berger-Bchi B. et al, Mol Gen Genet 219: 263-9 (1989)
[0111] 3. Berger-Bchi B. et al., Antimicrob. Agents Chemother. 36: 1367-73 (1992)
[0113] 5. de Lancastre H. et al., Antimicrob. Agents Chemother. 38: 2590-8 (1994)
[0114] 6. Hiramatsu K. et al., FEBS Letters 298: 133-6 (1992)
[0115] 7. Hurlimann-Dalel R. L. et al., Antimicrob. Agents Chemother. 36: 6+17-21 (1992)
[0116] 8. Kizaki M. et al., J. Hosp. Infect. 28: 287-95 (1994)
[0117] 9. Kleeman K. T. et al., J. Clin. Microbiol. 31: 1318-1321 (1993)
[0118] 10. Refshal K. et al., J. Hosp. Infect. 22(1): 19-31 (1992)
[0119] 11. Ryffel C. et al., Gene 94: 137-8 (1990)
[0120] 12. Ryffel C. et al., Antimicrob. Agents Chemother. 38: 724-8 (1994)
[0121] 13. Rupp M. E. et al., Clin. Infectious Diseases 19: 231-245 (1994)
[0122] 14. Stranden A. L. et al., J. Bacteriol. 179: 9-16 (1997)
[0123] 15. Suzuki E. et al., Antimicrob. Agents Chemother. 36: 429-34 (1992)
[0124] 16. Unal S. et al., J. Clin. Microb. 30: 1685-1691 (1992)
[0125] 17. Vannuffel P. et al., J. Clin. Microb. 33: 2864-2867 (1995)
[0126] 18. Vannuffel . et al., J. Clin. Microb. 36: 2366-2368 (1998)
Sequence CWU 1
83 1 1328 DNA Staphylococcus femA Consensus Sequence misc_feature (1)…(1328) n=any nucleotide 1 nnnnnnnnnn nnnanaatga antttacnaa tttnacngcn anaganttnn gnnnntntac 60 ngannnnatg ncnnanagnc atttnacnca nannnnngnn nantangann tnaannttgc 120 nnannnnnnn ganncncann tagtnggnat naanaanaan nataangang tnattgcngc 180 ntgnntnntn acngcngtnc cngtnatgaa antnttnaan tanttttatt cnaanngngg 240 nccngtnatn gattntnana annnaganct ngtncantnn ttctttaang anttnnnnaa 300 ntatntnaaa nannannntn nnntatannt nnnnntngan ccntanntnn cntatcaata 360 nnnnaatcat ganggngann tnnnngnnaa tgcnggnnan gattggntnt tngatnannt 420 nnnnnnnntn ggntntnanc annnnggntt nnnnannggn tttganccnn tnnnncaaat 480 nngntnncan tcngtnntan atttannnnn naaaannncn nanganntnn tnaannnnat 540 ggatngnntn ngnaanngna anacnaaaaa agtnnanaan aatggngtna aagtnnnntt 600 nntnnnnnaa ganganntnc cnatnttnng ntcattnatg gangatacnn cnganncnaa 660 ngnnttnnnn gatngngang annnnttnta ntanaanngn tnnnnnnatt nnaaagannn 720 ngtnntngtn ccnntngcnt atatnnantt tgatgantan ntnnnngaan tnnannnnga 780 nngnnannnn ntnantaaag annnnaanaa agcnntnaan ganatngana aangnccnga 840 naanaaaaan gcnnnnaana annnnnnnaa nntnnaanan caantnnnng cnaannanca 900 aaanntnnan gangnnannn nnntnnaann nnancatggn aangaattac cnatntcngc 960 ngnntncttn ntnatnaatc cntntgaagt ngtntantan gcnggtggna cntcnaatnn 1020 ntnnngncan ttngcnggna gntatgcnnt ncaatggnnn atgattaant atgcnntnna 1080 ncatnnnatn nanngntana atttntatgg nnttagnggt nantttanng angangcnga 1140 agatgnnggn gtnntnaant tnaaaaangg ntnnnatgcn ganntnntng antangttgg 1200 nganttnntn aaaccnatna anaanccnnt ntannnnnnn tatannncan tnaaaaannt 1260 nnannnnann nnnnnntann nannnnnnna nnnnannnnn nnnnnnatga aatttacaga 1320 gttaannn 1328 2 35 DNA Artificial Sequence Primer 2 anaatgaant ttacnaattt nacngcnana gantt 35 3 20 DNA Artificial Sequence Primer 3 taatgaagtt tacaaaattt 20 4 20 DNA Artificial Sequence Primer 4 taatgaagtt tacnaaattt 20 5 25 DNA Artificial Sequence Primer 5 atgncnnana gncatttnac ncana 25 6 20 DNA Artificial Sequence Primer 6 tgccatatag tcatttacgc 20 7 37 DNA Artificial Sequence Primer 7 tagtnggnat naanaanaan nataangang tnattgc 37 8 35 DNA Artificial Sequence Primer 8 gtnccngtna tgaaantntt naantanttt tattc 35 9 18 DNA Artificial Sequence Primer 9 aatgcnggnn angattgg 18 10 43 DNA Artificial Sequence Primer 10 gnaanngnaa nacnaaaaaa gtnnanaana atggngtnaa agt 43 11 18 DNA Artificial Sequence Primer 11 aaaaagttca aaaaatgg 18 12 18 DNA Artificial Sequence Primer 12 aaaaagtaca aaaaatgg 18 13 40 DNA Artificial Sequence Primer 13 aagangannt nccnatnttn ngntcattna tggangatac 40 14 20 DNA Artificial Sequence Primer 14 tatatnnant ttgatganta 20 15 32 DNA Artificial Sequence Primer 15 aanganatng anaaangncc nganaanaaa aa 32 16 18 DNA Artificial Sequence Primer 16 aaagatattg aaaaacga 18 17 20 DNA Artificial Sequence Primer 17 aaagatattg aaaagagacc 20 18 18 DNA Artificial Sequence Primer 18 aaagatatcg agaaagac 18 19 18 DNA Artificial Sequence Primer 19 aaagacatcg acaagcgt 18 20 22 DNA Artificial Sequence Primer 20 ancatggnaa ngaattaccn at 22 21 19 DNA Artificial Sequence Primer 21 gaacatggta atgaattac 19 22 32 DNA Artificial Sequence Primer 22 aatccntntg aagtngtnta ntangcnggt gg 32 23 35 DNA Artificial Sequence Primer 23 agntatgcnn tncaatggnn natgattaan tatgc 35 24 44 DNA Artificial Sequence Primer 24 tttanngang angcngaaga tgnnggngtn ntnaanttna aaaa 44 25 20 DNA Artificial Sequence Primer 25 tttactgaag atgctgaaga 20 26 20 DNA Artificial Sequence Primer 26 gttggngant tnntnaaacc 20 27 20 DNA Artificial Sequence Primer 27 gttggtgact ttattaaacc 20 28 19 DNA Artificial Sequence Primer 28 atgaaattta cagagttaa 19 29 18 DNA Artificial Sequence Primer 29 acagcagatg acatcatt 18 30 20 DNA Artificial Sequence Primer 30 taatgaaaga aatgtgctta 20 31 19 DNA Artificial Sequence Primer 31 acacaacttc aattagaac 19 32 17 DNA Artificial Sequence Primer 32 agtattagca aatgcgg 17 33 17 DNA Artificial Sequence Primer 33 atgcatattt tccgtaa 17 34 17 DNA Artificial Sequence Primer 34 cagcagatga catcatt 17 35 23 DNA Artificial Sequence Primer 35 catctaaaga tatattaaat gga 23 36 22 DNA Artificial Sequence Primer 36 agtattagca aatgcgggtc ac 22 37 20 DNA Artificial Sequence Primer 37 caacacaact tcaattagaa 20 38 20 DNA Artificial Sequence Primer 38 tggctatcgt gtcacaatcg 20 39 20 DNA Artificial Sequence Primer 39 ctggaacttg ttgagcagag 20 40 1305 DNA Staphylococcus haemolyticus femA CDS (4)…(1266) 40 ata atg aag ttt aca aat tta aca gct aca gag ttt ggc aat tat aca 48 Met Lys Phe Thr Asn Leu Thr Ala Thr Glu Phe Gly Asn Tyr Thr 1 5 10 15 gat aag atg cca tat agt cat ttc aca caa atg act gaa aac tat gag 96 Asp Lys Met Pro Tyr Ser His Phe Thr Gln Met Thr Glu Asn Tyr Glu 20 25 30 atg aaa gtt gca aat aaa aca gaa act cac tta gtt ggt ata aaa aat 144 Met Lys Val Ala Asn Lys Thr Glu Thr His Leu Val Gly Ile Lys Asn 35 40 45 aaa gat aat gag gtt att gca gcc tgc atg ttg aca gca gta cca gtc 192 Lys Asp Asn Glu Val Ile Ala Ala Cys Met Leu Thr Ala Val Pro Val 50 55 60 atg aaa ttt ttt aag tac ttt tat tct aac cga gga cct gta att gat 240 Met Lys Phe Phe Lys Tyr Phe Tyr Ser Asn Arg Gly Pro Val Ile Asp 65 70 75 tat gat aat aga gag ctt gtt cac ttt ttc ttt aat gag tta aca aag 288 Tyr Asp Asn Arg Glu Leu Val His Phe Phe Phe Asn Glu Leu Thr Lys 80 85 90 95 tat tta aaa cag cat aat tgt cta tat gtt cga gtt gac cct tat tta 336 Tyr Leu Lys Gln His Asn Cys Leu Tyr Val Arg Val Asp Pro Tyr Leu 100 105 110 cca tat caa tat tta aat cat gat ggt gaa att aca ggt aat gct ggt 384 Pro Tyr Gln Tyr Leu Asn His Asp Gly Glu Ile Thr Gly Asn Ala Gly 115 120 125 aat gat tgg ttc ttt gat aag atg aag cat ctc gga ttt gaa cat gaa 432 Asn Asp Trp Phe Phe Asp Lys Met Lys His Leu Gly Phe Glu His Glu 130 135 140 ggc ttt act aaa ggt ttt gat ccg att aaa caa atc cga tat cat tct 480 Gly Phe Thr Lys Gly Phe Asp Pro Ile Lys Gln Ile Arg Tyr His Ser 145 150 155 gtt tta gat tta aaa aat aaa aca tct aaa gat ata tta aat gga atg 528 Val Leu Asp Leu Lys Asn Lys Thr Ser Lys Asp Ile Leu Asn Gly Met 160 165 170 175 gat agt cta cgt aaa cgt aat act aaa aaa gtt caa aaa aat ggt gtg 576 Asp Ser Leu Arg Lys Arg Asn Thr Lys Lys Val Gln Lys Asn Gly Val 180 185 190 aaa gtt aag ttc tta tca gaa gaa gaa ctt cca atc ttc cgt tca ttt 624 Lys Val Lys Phe Leu Ser Glu Glu Glu Leu Pro Ile Phe Arg Ser Phe 195 200 205 atg gaa gat aca acc gaa acg aaa gaa ttc caa gat aga gat gat agt 672 Met Glu Asp Thr Thr Glu Thr Lys Glu Phe Gln Asp Arg Asp Asp Ser 210 215 220 ttc tat tat aat cgc tat aga cat ttc aaa gat cac gtg ctt gta cca 720 Phe Tyr Tyr Asn Arg Tyr Arg His Phe Lys Asp His Val Leu Val Pro 225 230 235 cta gct tat att aag ttt gat gag tac atc gaa gaa tta caa aat gaa 768 Leu Ala Tyr Ile Lys Phe Asp Glu Tyr Ile Glu Glu Leu Gln Asn Glu 240 245 250 255 cgt gaa act tta aat aaa gat gtt aat aaa gct tta aaa gat att gaa 816 Arg Glu Thr Leu Asn Lys Asp Val Asn Lys Ala Leu Lys Asp Ile Glu 260 265 270 aaa cga cca gac aat aaa aag gca ttt aat aaa aaa gaa aat ctt gaa 864 Lys Arg Pro Asp Asn Lys Lys Ala Phe Asn Lys Lys Glu Asn Leu Glu 275 280 285 aaa caa tta gat gcc aat caa caa aaa tta gac gag gct aaa aaa tta 912 Lys Gln Leu Asp Ala Asn Gln Gln Lys Leu Asp Glu Ala Lys Lys Leu 290 295 300 caa gcc gaa cat ggt aat gaa tta cca att tca gca ggt ttc ttc ttt 960 Gln Ala Glu His Gly Asn Glu Leu Pro Ile Ser Ala Gly Phe Phe Phe 305 310 315 att aat cca ttt gaa gtt gtt tat tat gca ggt gga act tct aat aaa 1008 Ile Asn Pro Phe Glu Val Val Tyr Tyr Ala Gly Gly Thr Ser Asn Lys 320 325 330 335 tat aga cat ttt gca ggc agt tat gct att caa tgg aca atg att aac 1056 Tyr Arg His Phe Ala Gly Ser Tyr Ala Ile Gln Trp Thr Met Ile Asn 340 345 350 tat gca att gat cat ggt att gat aga tac aat ttc tat ggt att agc 1104 Tyr Ala Ile Asp His Gly Ile Asp Arg Tyr Asn Phe Tyr Gly Ile Ser 355 360 365 ggt aat ttt agt gaa gac gct gaa gat gtt gga gtc att aaa ttt aaa 1152 Gly Asn Phe Ser Glu Asp Ala Glu Asp Val Gly Val Ile Lys Phe Lys 370 375 380 aaa ggt ttc aat gca gac gta att gag tat gtt gga gac ttt gtg aaa 1200 Lys Gly Phe Asn Ala Asp Val Ile Glu Tyr Val Gly Asp Phe Val Lys 385 390 395 cct att aac aaa cct ttg tat tca gtg tat aag aca ctc aaa aag att 1248 Pro Ile Asn Lys Pro Leu Tyr Ser Val Tyr Lys Thr Leu Lys Lys Ile 400 405 410 415 aaa aaa aga ttt aat taa agaggggaat agacgaatat gaaatttaca 1296 Lys Lys Arg Phe Asn * 420 gagttaaac 1305 41 420 PRT Staphylococcus haemolyticus femA 41 Met Lys Phe Thr Asn Leu Thr Ala Thr Glu Phe Gly Asn Tyr Thr Asp 1 5 10 15 Lys Met Pro Tyr Ser His Phe Thr Gln Met Thr Glu Asn Tyr Glu Met 20 25 30 Lys Val Ala Asn Lys Thr Glu Thr His Leu Val Gly Ile Lys Asn Lys 35 40 45 Asp Asn Glu Val Ile Ala Ala Cys Met Leu Thr Ala Val Pro Val Met 50 55 60 Lys Phe Phe Lys Tyr Phe Tyr Ser Asn Arg Gly Pro Val Ile Asp Tyr 65 70 75 80 Asp Asn Arg Glu Leu Val His Phe Phe Phe Asn Glu Leu Thr Lys Tyr 85 90 95 Leu Lys Gln His Asn Cys Leu Tyr Val Arg Val Asp Pro Tyr Leu Pro 100 105 110 Tyr Gln Tyr Leu Asn His Asp Gly Glu Ile Thr Gly Asn Ala Gly Asn 115 120 125 Asp Trp Phe Phe Asp Lys Met Lys His Leu Gly Phe Glu His Glu Gly 130 135 140 Phe Thr Lys Gly Phe Asp Pro Ile Lys Gln Ile Arg Tyr His Ser Val 145 150 155 160 Leu Asp Leu Lys Asn Lys Thr Ser Lys Asp Ile Leu Asn Gly Met Asp 165 170 175 Ser Leu Arg Lys Arg Asn Thr Lys Lys Val Gln Lys Asn Gly Val Lys 180 185 190 Val Lys Phe Leu Ser Glu Glu Glu Leu Pro Ile Phe Arg Ser Phe Met 195 200 205 Glu Asp Thr Thr Glu Thr Lys Glu Phe Gln Asp Arg Asp Asp Ser Phe 210 215 220 Tyr Tyr Asn Arg Tyr Arg His Phe Lys Asp His Val Leu Val Pro Leu 225 230 235 240 Ala Tyr Ile Lys Phe Asp Glu Tyr Ile Glu Glu Leu Gln Asn Glu Arg 245 250 255 Glu Thr Leu Asn Lys Asp Val Asn Lys Ala Leu Lys Asp Ile Glu Lys 260 265 270 Arg Pro Asp Asn Lys Lys Ala Phe Asn Lys Lys Glu Asn Leu Glu Lys 275 280 285 Gln Leu Asp Ala Asn Gln Gln Lys Leu Asp Glu Ala Lys Lys Leu Gln 290 295 300 Ala Glu His Gly Asn Glu Leu Pro Ile Ser Ala Gly Phe Phe Phe Ile 305 310 315 320 Asn Pro Phe Glu Val Val Tyr Tyr Ala Gly Gly Thr Ser Asn Lys Tyr 325 330 335 Arg His Phe Ala Gly Ser Tyr Ala Ile Gln Trp Thr Met Ile Asn Tyr 340 345 350 Ala Ile Asp His Gly Ile Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly 355 360 365 Asn Phe Ser Glu Asp Ala Glu Asp Val Gly Val Ile Lys Phe Lys Lys 370 375 380 Gly Phe Asn Ala Asp Val Ile Glu Tyr Val Gly Asp Phe Val Lys Pro 385 390 395 400 Ile Asn Lys Pro Leu Tyr Ser Val Tyr Lys Thr Leu Lys Lys Ile Lys 405 410 415 Lys Arg Phe Asn 420 42 1280 DNA Staphylococcus lugdunensis femA CDS (1)…(1242) 42 aca gca aat gaa ttc ggt gat ttc aca gat caa atg cca tat agt cat 48 Thr Ala Asn Glu Phe Gly Asp Phe Thr Asp Gln Met Pro Tyr Ser His 1 5 10 15 ttt act caa atg aca ggt aac tat aat tta aaa gtt gcc gaa aaa aca 96 Phe Thr Gln Met Thr Gly Asn Tyr Asn Leu Lys Val Ala Glu Lys Thr 20 25 30 gaa aca cat tta gtt ggt gtt aaa aat aat aat aac gaa gta att gca 144 Glu Thr His Leu Val Gly Val Lys Asn Asn Asn Asn Glu Val Ile Ala 35 40 45 gca tgt tta ttg aca gct gta cca gtc atg aag ttt ttt aaa tac ttt 192 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Phe Phe Lys Tyr Phe 50 55 60 tac agc aat aga ggc cca gtt ata gat tat gct aac caa gaa ctt gta 240 Tyr Ser Asn Arg Gly Pro Val Ile Asp Tyr Ala Asn Gln Glu Leu Val 65 70 75 80 cat ttt ttc ttt aat gag cta act aaa tat tta aaa aag tat aac tgt 288 His Phe Phe Phe Asn Glu Leu Thr Lys Tyr Leu Lys Lys Tyr Asn Cys 85 90 95 ctc tat gtc cgc ata gat cca tac tta cct tat caa tat aga gac cat 336 Leu Tyr Val Arg Ile Asp Pro Tyr Leu Pro Tyr Gln Tyr Arg Asp His 100 105 110 gac ggt aat ata acg gca aat gct ggc aat gat tgg ttt ttc aat aaa 384 Asp Gly Asn Ile Thr Ala Asn Ala Gly Asn Asp Trp Phe Phe Asn Lys 115 120 125 atg gaa caa ctc gga tac cat cat gat ggc ttt aca aca gga ttt gat 432 Met Glu Gln Leu Gly Tyr His His Asp Gly Phe Thr Thr Gly Phe Asp 130 135 140 cca ata tta caa atc aga ttc cat tct att ctt aat tta aag gat aag 480 Pro Ile Leu Gln Ile Arg Phe His Ser Ile Leu Asn Leu Lys Asp Lys 145 150 155 160 aca gct aaa gat gtt tta aat aat atg gat agt tta cgt aaa aga aat 528 Thr Ala Lys Asp Val Leu Asn Asn Met Asp Ser Leu Arg Lys Arg Asn 165 170 175 acc aaa aaa agt tca aaa aat gga gtc aaa gta aag ttc ctt act gaa 576 Thr Lys Lys Ser Ser Lys Asn Gly Val Lys Val Lys Phe Leu Thr Glu 180 185 190 gaa gaa cta cct atc ttt cgt tca ttt atg gag cag acg tca gaa tct 624 Glu Glu Leu Pro Ile Phe Arg Ser Phe Met Glu Gln Thr Ser Glu Ser 195 200 205 aaa gaa ttc tct gat aga gac gac caa ttt tat tac aat cgg ttt aag 672 Lys Glu Phe Ser Asp Arg Asp Asp Gln Phe Tyr Tyr Asn Arg Phe Lys 210 215 220 tac tat aaa gat agg gtg ctt gtg cct cta gca tat tta aaa ttt gat 720 Tyr Tyr Lys Asp Arg Val Leu Val Pro Leu Ala Tyr Leu Lys Phe Asp 225 230 235 240 gaa tat ata gaa gaa cta acg aat gaa cga caa act tta gaa aaa gat 768 Glu Tyr Ile Glu Glu Leu Thr Asn Glu Arg Gln Thr Leu Glu Lys Asp 245 250 255 tta ggc aaa gca ctt aaa gac att gag aaa cga cca gat aac aaa aaa 816 Leu Gly Lys Ala Leu Lys Asp Ile Glu Lys Arg Pro Asp Asn Lys Lys 260 265 270 gct tat aat aaa cga gac aac cta caa caa caa ctc gat gcc aat caa 864 Ala Tyr Asn Lys Arg Asp Asn Leu Gln Gln Gln Leu Asp Ala Asn Gln 275 280 285 caa aag tta aat gag gct aat cag tta caa gcg gaa cac ggt aat gag 912 Gln Lys Leu Asn Glu Ala Asn Gln Leu Gln Ala Glu His Gly Asn Glu 290
295 300 tta cct atc tct gcc ggt ttc ttt att att aat ccg ttt gaa gtt gta 960 Leu Pro Ile Ser Ala Gly Phe Phe Ile Ile Asn Pro Phe Glu Val Val 305 310 315 320 tac tac gct gga ggt acc gct aat aaa tat cgt cat ttt gca ggt agt 1008 Tyr Tyr Ala Gly Gly Thr Ala Asn Lys Tyr Arg His Phe Ala Gly Ser 325 330 335 tac gcg gtt cag tgg act atg att aac tat gct atc gaa cac ggc ata 1056 Tyr Ala Val Gln Trp Thr Met Ile Asn Tyr Ala Ile Glu His Gly Ile 340 345 350 gac aga tat aat ttc tac ggc att agt gga aac ttc tca gat gat gct 1104 Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly Asn Phe Ser Asp Asp Ala 355 360 365 gaa gac gca ggt gtc att cgc ttt aaa aaa ggt tat ggt gca gaa gtg 1152 Glu Asp Ala Gly Val Ile Arg Phe Lys Lys Gly Tyr Gly Ala Glu Val 370 375 380 att gaa tac gtt ggt gat ttt gta aaa cct ata aat aaa cct atg tat 1200 Ile Glu Tyr Val Gly Asp Phe Val Lys Pro Ile Asn Lys Pro Met Tyr 385 390 395 400 aaa ctt tat tca gtg tta aaa cga att caa aat aag cta tag 1242 Lys Leu Tyr Ser Val Leu Lys Arg Ile Gln Asn Lys Leu * 405 410 aggagaatgg attaattatg aaatttacag agtttaac 1280 43 413 PRT Staphylococcus lugdunensis femA 43 Thr Ala Asn Glu Phe Gly Asp Phe Thr Asp Gln Met Pro Tyr Ser His 1 5 10 15 Phe Thr Gln Met Thr Gly Asn Tyr Asn Leu Lys Val Ala Glu Lys Thr 20 25 30 Glu Thr His Leu Val Gly Val Lys Asn Asn Asn Asn Glu Val Ile Ala 35 40 45 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Phe Phe Lys Tyr Phe 50 55 60 Tyr Ser Asn Arg Gly Pro Val Ile Asp Tyr Ala Asn Gln Glu Leu Val 65 70 75 80 His Phe Phe Phe Asn Glu Leu Thr Lys Tyr Leu Lys Lys Tyr Asn Cys 85 90 95 Leu Tyr Val Arg Ile Asp Pro Tyr Leu Pro Tyr Gln Tyr Arg Asp His 100 105 110 Asp Gly Asn Ile Thr Ala Asn Ala Gly Asn Asp Trp Phe Phe Asn Lys 115 120 125 Met Glu Gln Leu Gly Tyr His His Asp Gly Phe Thr Thr Gly Phe Asp 130 135 140 Pro Ile Leu Gln Ile Arg Phe His Ser Ile Leu Asn Leu Lys Asp Lys 145 150 155 160 Thr Ala Lys Asp Val Leu Asn Asn Met Asp Ser Leu Arg Lys Arg Asn 165 170 175 Thr Lys Lys Ser Ser Lys Asn Gly Val Lys Val Lys Phe Leu Thr Glu 180 185 190 Glu Glu Leu Pro Ile Phe Arg Ser Phe Met Glu Gln Thr Ser Glu Ser 195 200 205 Lys Glu Phe Ser Asp Arg Asp Asp Gln Phe Tyr Tyr Asn Arg Phe Lys 210 215 220 Tyr Tyr Lys Asp Arg Val Leu Val Pro Leu Ala Tyr Leu Lys Phe Asp 225 230 235 240 Glu Tyr Ile Glu Glu Leu Thr Asn Glu Arg Gln Thr Leu Glu Lys Asp 245 250 255 Leu Gly Lys Ala Leu Lys Asp Ile Glu Lys Arg Pro Asp Asn Lys Lys 260 265 270 Ala Tyr Asn Lys Arg Asp Asn Leu Gln Gln Gln Leu Asp Ala Asn Gln 275 280 285 Gln Lys Leu Asn Glu Ala Asn Gln Leu Gln Ala Glu His Gly Asn Glu 290 295 300 Leu Pro Ile Ser Ala Gly Phe Phe Ile Ile Asn Pro Phe Glu Val Val 305 310 315 320 Tyr Tyr Ala Gly Gly Thr Ala Asn Lys Tyr Arg His Phe Ala Gly Ser 325 330 335 Tyr Ala Val Gln Trp Thr Met Ile Asn Tyr Ala Ile Glu His Gly Ile 340 345 350 Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly Asn Phe Ser Asp Asp Ala 355 360 365 Glu Asp Ala Gly Val Ile Arg Phe Lys Lys Gly Tyr Gly Ala Glu Val 370 375 380 Ile Glu Tyr Val Gly Asp Phe Val Lys Pro Ile Asn Lys Pro Met Tyr 385 390 395 400 Lys Leu Tyr Ser Val Leu Lys Arg Ile Gln Asn Lys Leu 405 410 44 1295 DNA Staphylococcus xylosus femA CDS (1)…(1245) 44 acg caa aag agt ttg ggt gca ttt tca gat aaa atg cca aat agc cat 48 Thr Gln Lys Ser Leu Gly Ala Phe Ser Asp Lys Met Pro Asn Ser His 1 5 10 15 ttc acg caa atg gta ggg aat tat gaa ttg aaa att gca gaa agt act 96 Phe Thr Gln Met Val Gly Asn Tyr Glu Leu Lys Ile Ala Glu Ser Thr 20 25 30 gaa aca cat tta gta ggt ata aaa aac aat gat aat gaa gtc att gca 144 Glu Thr His Leu Val Gly Ile Lys Asn Asn Asp Asn Glu Val Ile Ala 35 40 45 gct tgt tta tta act gca gta cca gta atg aaa ttc ttt aag tat ttt 192 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Phe Phe Lys Tyr Phe 50 55 60 tat act aat aga ggt ccg gtt ata gat ttt gaa aat aaa gaa tta gtg 240 Tyr Thr Asn Arg Gly Pro Val Ile Asp Phe Glu Asn Lys Glu Leu Val 65 70 75 80 cat tac ttt ttc aat gaa cta tct aaa tat gtg aaa aaa cat aat gcg 288 His Tyr Phe Phe Asn Glu Leu Ser Lys Tyr Val Lys Lys His Asn Ala 85 90 95 ctt tat tta aga gtt gat cct tat tta gca tat caa tac cgt aat cat 336 Leu Tyr Leu Arg Val Asp Pro Tyr Leu Ala Tyr Gln Tyr Arg Asn His 100 105 110 gat ggt gag gta ttg gaa aat gca gga cat gat tgg att ttc gat aaa 384 Asp Gly Glu Val Leu Glu Asn Ala Gly His Asp Trp Ile Phe Asp Lys 115 120 125 atg aag cag ctt gga tat aaa cac caa gga ttt tta act ggt ttc gat 432 Met Lys Gln Leu Gly Tyr Lys His Gln Gly Phe Leu Thr Gly Phe Asp 130 135 140 tca att att caa att agg ttc cac tct gta ctg gat tta gta ggt aaa 480 Ser Ile Ile Gln Ile Arg Phe His Ser Val Leu Asp Leu Val Gly Lys 145 150 155 160 act gct aaa gat gta cta aat ggt atg gat agt tta cgt aaa cgt aat 528 Thr Ala Lys Asp Val Leu Asn Gly Met Asp Ser Leu Arg Lys Arg Asn 165 170 175 act aaa aaa gta caa aaa aat ggc gtg aaa gta agg ttc tta agg gaa 576 Thr Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Phe Leu Arg Glu 180 185 190 gat gag ttg cca att ttc cgt tca ttc atg gaa gat aca tct gaa act 624 Asp Glu Leu Pro Ile Phe Arg Ser Phe Met Glu Asp Thr Ser Glu Thr 195 200 205 aaa gac ttt gac gat aga gac gat ggc ttt tac tac aat aga tta agg 672 Lys Asp Phe Asp Asp Arg Asp Asp Gly Phe Tyr Tyr Asn Arg Leu Arg 210 215 220 tat tat aaa gat cgc gta tta gta cct cta gct tat atg gat ttc aat 720 Tyr Tyr Lys Asp Arg Val Leu Val Pro Leu Ala Tyr Met Asp Phe Asn 225 230 235 240 gaa tat att gaa gaa ttg caa gct gaa cgt gag gtg tta agc aaa gat 768 Glu Tyr Ile Glu Glu Leu Gln Ala Glu Arg Glu Val Leu Ser Lys Asp 245 250 255 atc aat aaa gca gta aaa gat atc gag aaa aga cct gaa aat aaa aaa 816 Ile Asn Lys Ala Val Lys Asp Ile Glu Lys Arg Pro Glu Asn Lys Lys 260 265 270 gca tat aat aaa aaa gat aat cta gag aaa caa ctt ata gcg aat caa 864 Ala Tyr Asn Lys Lys Asp Asn Leu Glu Lys Gln Leu Ile Ala Asn Gln 275 280 285 caa aaa att gat gaa gct aaa act cta caa gag aag cat ggt aac gaa 912 Gln Lys Ile Asp Glu Ala Lys Thr Leu Gln Glu Lys His Gly Asn Glu 290 295 300 cta cca atc tca gca gca tat ttc atc att aac cct tat gaa gta gtg 960 Leu Pro Ile Ser Ala Ala Tyr Phe Ile Ile Asn Pro Tyr Glu Val Val 305 310 315 320 tat tat gcg ggt gga acg tca aat gag ttt aga cat ttt gct ggt agt 1008 Tyr Tyr Ala Gly Gly Thr Ser Asn Glu Phe Arg His Phe Ala Gly Ser 325 330 335 tat gcc att caa tgg aag atg att aac tat gct att gac cat aat att 1056 Tyr Ala Ile Gln Trp Lys Met Ile Asn Tyr Ala Ile Asp His Asn Ile 340 345 350 gat aga tat aat ttt tat gga att agt ggt cat ttt aca gaa gat gca 1104 Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly His Phe Thr Glu Asp Ala 355 360 365 gaa gat gcc ggt gta gtt aaa ttt aaa aaa gga ttt aat gcg gat gta 1152 Glu Asp Ala Gly Val Val Lys Phe Lys Lys Gly Phe Asn Ala Asp Val 370 375 380 gtg gaa tat gtt ggt gat ttt att aaa cca atc aat aaa cca atg tac 1200 Val Glu Tyr Val Gly Asp Phe Ile Lys Pro Ile Asn Lys Pro Met Tyr 385 390 395 400 aaa att tat acg aca tta aag aaa att aaa gat aaa aag aaa taa 1245 Lys Ile Tyr Thr Thr Leu Lys Lys Ile Lys Asp Lys Lys Lys * 405 410 acatttaata gaagggaact aagctagaat gaaatttaca gagttaaacc 1295 45 414 PRT Staphylococcus xylosus femA 45 Thr Gln Lys Ser Leu Gly Ala Phe Ser Asp Lys Met Pro Asn Ser His 1 5 10 15 Phe Thr Gln Met Val Gly Asn Tyr Glu Leu Lys Ile Ala Glu Ser Thr 20 25 30 Glu Thr His Leu Val Gly Ile Lys Asn Asn Asp Asn Glu Val Ile Ala 35 40 45 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Phe Phe Lys Tyr Phe 50 55 60 Tyr Thr Asn Arg Gly Pro Val Ile Asp Phe Glu Asn Lys Glu Leu Val 65 70 75 80 His Tyr Phe Phe Asn Glu Leu Ser Lys Tyr Val Lys Lys His Asn Ala 85 90 95 Leu Tyr Leu Arg Val Asp Pro Tyr Leu Ala Tyr Gln Tyr Arg Asn His 100 105 110 Asp Gly Glu Val Leu Glu Asn Ala Gly His Asp Trp Ile Phe Asp Lys 115 120 125 Met Lys Gln Leu Gly Tyr Lys His Gln Gly Phe Leu Thr Gly Phe Asp 130 135 140 Ser Ile Ile Gln Ile Arg Phe His Ser Val Leu Asp Leu Val Gly Lys 145 150 155 160 Thr Ala Lys Asp Val Leu Asn Gly Met Asp Ser Leu Arg Lys Arg Asn 165 170 175 Thr Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Phe Leu Arg Glu 180 185 190 Asp Glu Leu Pro Ile Phe Arg Ser Phe Met Glu Asp Thr Ser Glu Thr 195 200 205 Lys Asp Phe Asp Asp Arg Asp Asp Gly Phe Tyr Tyr Asn Arg Leu Arg 210 215 220 Tyr Tyr Lys Asp Arg Val Leu Val Pro Leu Ala Tyr Met Asp Phe Asn 225 230 235 240 Glu Tyr Ile Glu Glu Leu Gln Ala Glu Arg Glu Val Leu Ser Lys Asp 245 250 255 Ile Asn Lys Ala Val Lys Asp Ile Glu Lys Arg Pro Glu Asn Lys Lys 260 265 270 Ala Tyr Asn Lys Lys Asp Asn Leu Glu Lys Gln Leu Ile Ala Asn Gln 275 280 285 Gln Lys Ile Asp Glu Ala Lys Thr Leu Gln Glu Lys His Gly Asn Glu 290 295 300 Leu Pro Ile Ser Ala Ala Tyr Phe Ile Ile Asn Pro Tyr Glu Val Val 305 310 315 320 Tyr Tyr Ala Gly Gly Thr Ser Asn Glu Phe Arg His Phe Ala Gly Ser 325 330 335 Tyr Ala Ile Gln Trp Lys Met Ile Asn Tyr Ala Ile Asp His Asn Ile 340 345 350 Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly His Phe Thr Glu Asp Ala 355 360 365 Glu Asp Ala Gly Val Val Lys Phe Lys Lys Gly Phe Asn Ala Asp Val 370 375 380 Val Glu Tyr Val Gly Asp Phe Ile Lys Pro Ile Asn Lys Pro Met Tyr 385 390 395 400 Lys Ile Tyr Thr Thr Leu Lys Lys Ile Lys Asp Lys Lys Lys 405 410 46 1283 DNA Staphylococcus capitis femA CDS (1)…(1236) 46 aca gct aaa gaa ttt agt gac ttt act gat caa atg cct tat agc cat 48 Thr Ala Lys Glu Phe Ser Asp Phe Thr Asp Gln Met Pro Tyr Ser His 1 5 10 15 ttt act cag atg gaa ggt aat tat gaa ctt aaa gtt gct gaa ggt acg 96 Phe Thr Gln Met Glu Gly Asn Tyr Glu Leu Lys Val Ala Glu Gly Thr 20 25 30 gat tca cat ctc gta gga att aaa aat aat gac aac caa gtg att gca 144 Asp Ser His Leu Val Gly Ile Lys Asn Asn Asp Asn Gln Val Ile Ala 35 40 45 gca tgt tta tta act gct gta cct gta atg aaa att ttt aaa tat ttt 192 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Ile Phe Lys Tyr Phe 50 55 60 tac tca aat cgc ggg cca gtg att gat tat gat aat aaa gag ctt gtt 240 Tyr Ser Asn Arg Gly Pro Val Ile Asp Tyr Asp Asn Lys Glu Leu Val 65 70 75 80 cac ttt ttc ttt aat gaa tta agt aaa tat gta aaa aag cat aat tgt 288 His Phe Phe Phe Asn Glu Leu Ser Lys Tyr Val Lys Lys His Asn Cys 85 90 95 ctt tat cta aga gtt gac cct tat ctt cct tat caa tac tta aat cat 336 Leu Tyr Leu Arg Val Asp Pro Tyr Leu Pro Tyr Gln Tyr Leu Asn His 100 105 110 gac ggt gaa att att gga aat gct ggc cat gat tgg ttt ttc aat aag 384 Asp Gly Glu Ile Ile Gly Asn Ala Gly His Asp Trp Phe Phe Asn Lys 115 120 125 atg gaa gaa tta gga ttt gaa cat gaa ggc ttt cat aaa ggc ttc cat 432 Met Glu Glu Leu Gly Phe Glu His Glu Gly Phe His Lys Gly Phe His 130 135 140 cct atc tta caa gta aga tat cat tca gtt tta gat tta aaa gat aaa 480 Pro Ile Leu Gln Val Arg Tyr His Ser Val Leu Asp Leu Lys Asp Lys 145 150 155 160 acg gct aaa gat gta ctc aaa gga atg gat agt tta aga aag cgt aat 528 Thr Ala Lys Asp Val Leu Lys Gly Met Asp Ser Leu Arg Lys Arg Asn 165 170 175 act aag aaa gta caa aaa aat ggt gtc aaa gtc cgt ttc cta tcc gaa 576 Thr Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Phe Leu Ser Glu 180 185 190 gat gaa tta cct atc ttt aga tca ttt atg gaa gat act aca gaa acg 624 Asp Glu Leu Pro Ile Phe Arg Ser Phe Met Glu Asp Thr Thr Glu Thr 195 200 205 aaa gag ttc gcc gat aga gat gat agt ttc tat tat aat cga tta aaa 672 Lys Glu Phe Ala Asp Arg Asp Asp Ser Phe Tyr Tyr Asn Arg Leu Lys 210 215 220 tac ttt aaa gat aga gta tta gta cca tta gca tat gtt gac ttc gat 720 Tyr Phe Lys Asp Arg Val Leu Val Pro Leu Ala Tyr Val Asp Phe Asp 225 230 235 240 gag tat att gaa gaa ctt aat aat gaa aga gat gtt ctt aat aaa gat 768 Glu Tyr Ile Glu Glu Leu Asn Asn Glu Arg Asp Val Leu Asn Lys Asp 245 250 255 tta aat aag gcg ctc aaa gat att gag aag aga cct gat aat aag aaa 816 Leu Asn Lys Ala Leu Lys Asp Ile Glu Lys Arg Pro Asp Asn Lys Lys 260 265 270 gct tat aac aaa aga gat aat ctt caa caa caa tta gat gca aat caa 864 Ala Tyr Asn Lys Arg Asp Asn Leu Gln Gln Gln Leu Asp Ala Asn Gln 275 280 285 caa aaa att gat gaa gct aaa aac tta caa caa gaa cat ggt aat gaa 912 Gln Lys Ile Asp Glu Ala Lys Asn Leu Gln Gln Glu His Gly Asn Glu 290 295 300 tta cct att tca gct gga tat ttc ttc att aat ccg ttt gaa gtt gtt 960 Leu Pro Ile Ser Ala Gly Tyr Phe Phe Ile Asn Pro Phe Glu Val Val 305 310 315 320 tat tac gca ggt ggc aca tcg aat cgt tat cgt cac tat gcc gga agt 1008 Tyr Tyr Ala Gly Gly Thr Ser Asn Arg Tyr Arg His Tyr Ala Gly Ser 325 330 335 tat gca att caa tgg aaa atg ata aac tat gct tta gaa cat gga att 1056 Tyr Ala Ile Gln Trp Lys Met Ile Asn Tyr Ala Leu Glu His Gly Ile 340 345 350 aac cgt tat aat ttt tat gga gtt agt ggg gac ttc agt gaa gac gct 1104 Asn Arg Tyr Asn Phe Tyr Gly Val Ser Gly Asp Phe Ser Glu Asp Ala 355 360 365 gaa gat gta gga gta att aag ttc aaa aaa ggc tat aat gct gat gtt 1152 Glu Asp Val Gly Val Ile Lys Phe Lys Lys Gly Tyr Asn Ala Asp Val 370 375 380 att gaa tat gta ggt gat ttt atc aag cca atc aat aaa cct atg tat 1200 Ile Glu Tyr Val Gly Asp Phe Ile Lys Pro Ile Asn Lys Pro Met Tyr 385 390 395 400 gca atc tat aac gca ctt aaa aag tta aag aaa tag atttttttac 1246 Ala Ile Tyr Asn Ala Leu Lys Lys Leu Lys Lys * 405 410 caacccaatt atctaattat gaaatttaca gagttaa 1283 47 411 PRT Staphylococcus capitis femA 47 Thr Ala Lys Glu Phe Ser Asp Phe Thr Asp Gln Met Pro Tyr Ser His 1 5 10 15 Phe Thr Gln Met Glu Gly Asn Tyr Glu Leu Lys Val Ala Glu Gly Thr 20 25 30 Asp Ser His Leu Val Gly Ile Lys Asn Asn Asp Asn Gln Val Ile Ala 35
40 45 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Ile Phe Lys Tyr Phe 50 55 60 Tyr Ser Asn Arg Gly Pro Val Ile Asp Tyr Asp Asn Lys Glu Leu Val 65 70 75 80 His Phe Phe Phe Asn Glu Leu Ser Lys Tyr Val Lys Lys His Asn Cys 85 90 95 Leu Tyr Leu Arg Val Asp Pro Tyr Leu Pro Tyr Gln Tyr Leu Asn His 100 105 110 Asp Gly Glu Ile Ile Gly Asn Ala Gly His Asp Trp Phe Phe Asn Lys 115 120 125 Met Glu Glu Leu Gly Phe Glu His Glu Gly Phe His Lys Gly Phe His 130 135 140 Pro Ile Leu Gln Val Arg Tyr His Ser Val Leu Asp Leu Lys Asp Lys 145 150 155 160 Thr Ala Lys Asp Val Leu Lys Gly Met Asp Ser Leu Arg Lys Arg Asn 165 170 175 Thr Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Phe Leu Ser Glu 180 185 190 Asp Glu Leu Pro Ile Phe Arg Ser Phe Met Glu Asp Thr Thr Glu Thr 195 200 205 Lys Glu Phe Ala Asp Arg Asp Asp Ser Phe Tyr Tyr Asn Arg Leu Lys 210 215 220 Tyr Phe Lys Asp Arg Val Leu Val Pro Leu Ala Tyr Val Asp Phe Asp 225 230 235 240 Glu Tyr Ile Glu Glu Leu Asn Asn Glu Arg Asp Val Leu Asn Lys Asp 245 250 255 Leu Asn Lys Ala Leu Lys Asp Ile Glu Lys Arg Pro Asp Asn Lys Lys 260 265 270 Ala Tyr Asn Lys Arg Asp Asn Leu Gln Gln Gln Leu Asp Ala Asn Gln 275 280 285 Gln Lys Ile Asp Glu Ala Lys Asn Leu Gln Gln Glu His Gly Asn Glu 290 295 300 Leu Pro Ile Ser Ala Gly Tyr Phe Phe Ile Asn Pro Phe Glu Val Val 305 310 315 320 Tyr Tyr Ala Gly Gly Thr Ser Asn Arg Tyr Arg His Tyr Ala Gly Ser 325 330 335 Tyr Ala Ile Gln Trp Lys Met Ile Asn Tyr Ala Leu Glu His Gly Ile 340 345 350 Asn Arg Tyr Asn Phe Tyr Gly Val Ser Gly Asp Phe Ser Glu Asp Ala 355 360 365 Glu Asp Val Gly Val Ile Lys Phe Lys Lys Gly Tyr Asn Ala Asp Val 370 375 380 Ile Glu Tyr Val Gly Asp Phe Ile Lys Pro Ile Asn Lys Pro Met Tyr 385 390 395 400 Ala Ile Tyr Asn Ala Leu Lys Lys Leu Lys Lys 405 410 48 1297 DNA Staphylococcus schleiferi femA CDS (1)…(1248) 48 acg acg gct gaa ttt ggt gcg ttt aca gat caa atg cca tat agc cat 48 Thr Thr Ala Glu Phe Gly Ala Phe Thr Asp Gln Met Pro Tyr Ser His 1 5 10 15 ttc acg caa atg gta ggg aac tat gaa tta aag gtt gct gaa ggt gtt 96 Phe Thr Gln Met Val Gly Asn Tyr Glu Leu Lys Val Ala Glu Gly Val 20 25 30 gaa aca cat ctt gtc ggc att aaa gat aac aac aat aac gta cta gca 144 Glu Thr His Leu Val Gly Ile Lys Asp Asn Asn Asn Asn Val Leu Ala 35 40 45 gca tgt tta ctg aca gca gtg cca gta atg aag ttt ttt aaa tat ttt 192 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Phe Phe Lys Tyr Phe 50 55 60 tat tca aac cgc gga cca gtc atg gac tac gaa aat aaa gag ctc gtt 240 Tyr Ser Asn Arg Gly Pro Val Met Asp Tyr Glu Asn Lys Glu Leu Val 65 70 75 80 cat ttc ttt ttt aat gaa ctt tca aaa tat gtt aag aaa tat cac gca 288 His Phe Phe Phe Asn Glu Leu Ser Lys Tyr Val Lys Lys Tyr His Ala 85 90 95 ttg tat ttg aga gta gac cct tat tta cca atg tta aag cga aac cat 336 Leu Tyr Leu Arg Val Asp Pro Tyr Leu Pro Met Leu Lys Arg Asn His 100 105 110 gat ggt gaa gtg att gaa aga tac ggc agt gac tgg ttt ttt gat aaa 384 Asp Gly Glu Val Ile Glu Arg Tyr Gly Ser Asp Trp Phe Phe Asp Lys 115 120 125 atg gct gaa tta aac ttt gaa cat gaa ggt ttc aca act ggg ttt gat 432 Met Ala Glu Leu Asn Phe Glu His Glu Gly Phe Thr Thr Gly Phe Asp 130 135 140 aca ata agg caa att cgt ttt cat tct gtg ctc gat gtt gaa aat aaa 480 Thr Ile Arg Gln Ile Arg Phe His Ser Val Leu Asp Val Glu Asn Lys 145 150 155 160 aca tca aaa gac atc tta aat caa atg gat aat tta agg aaa aga aat 528 Thr Ser Lys Asp Ile Leu Asn Gln Met Asp Asn Leu Arg Lys Arg Asn 165 170 175 acg aaa aaa gta cag aaa aat ggt gtg aaa gtc cgc tat cta aac gaa 576 Thr Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Tyr Leu Asn Glu 180 185 190 gat gaa tta cat att ttc cgt tcg ttt atg gaa gat aca tct gaa aca 624 Asp Glu Leu His Ile Phe Arg Ser Phe Met Glu Asp Thr Ser Glu Thr 195 200 205 aaa gat ttt gta gat aga gat gac gat ttt tat tat cat cgt atg aaa 672 Lys Asp Phe Val Asp Arg Asp Asp Asp Phe Tyr Tyr His Arg Met Lys 210 215 220 tac tat aaa gat cgt gtc cgc gta cca cta gcg tat att gat ttt aat 720 Tyr Tyr Lys Asp Arg Val Arg Val Pro Leu Ala Tyr Ile Asp Phe Asn 225 230 235 240 gca tat tta gca gag ctc aac act gaa gcg caa gac ttt aaa aaa gaa 768 Ala Tyr Leu Ala Glu Leu Asn Thr Glu Ala Gln Asp Phe Lys Lys Glu 245 250 255 att gca aaa gca gat aaa gac atc gac aag cgt cct gaa aat cag aaa 816 Ile Ala Lys Ala Asp Lys Asp Ile Asp Lys Arg Pro Glu Asn Gln Lys 260 265 270 gcc ata aat aaa aag aaa aat tta gag caa caa cta gaa gcg aat caa 864 Ala Ile Asn Lys Lys Lys Asn Leu Glu Gln Gln Leu Glu Ala Asn Gln 275 280 285 gct aaa ata aaa gaa gca gaa aca ttg caa ctt aaa cac ggt gac aca 912 Ala Lys Ile Lys Glu Ala Glu Thr Leu Gln Leu Lys His Gly Asp Thr 290 295 300 tta ccg att tcg gct gga ttc ttt att att aat cca ttt gag gtt gtt 960 Leu Pro Ile Ser Ala Gly Phe Phe Ile Ile Asn Pro Phe Glu Val Val 305 310 315 320 tat tat gca ggc ggc aca gca aac gaa ttt cgt cat ttt gct gga agc 1008 Tyr Tyr Ala Gly Gly Thr Ala Asn Glu Phe Arg His Phe Ala Gly Ser 325 330 335 tac gca gtg caa tgg gaa atg att aat tat gcg att gat tat caa att 1056 Tyr Ala Val Gln Trp Glu Met Ile Asn Tyr Ala Ile Asp Tyr Gln Ile 340 345 350 cca aga tat aac ttt tat ggc att agt ggt gat ttt tca gaa gat gca 1104 Pro Arg Tyr Asn Phe Tyr Gly Ile Ser Gly Asp Phe Ser Glu Asp Ala 355 360 365 gaa gat gca ggt gtg ata aaa ttt aaa aaa ggc tat aat gca gaa gta 1152 Glu Asp Ala Gly Val Ile Lys Phe Lys Lys Gly Tyr Asn Ala Glu Val 370 375 380 ata gaa tat gtc ggt gat ttt att aag cct ata aac aaa cct gcc tat 1200 Ile Glu Tyr Val Gly Asp Phe Ile Lys Pro Ile Asn Lys Pro Ala Tyr 385 390 395 400 aca gtc tac tta aaa tta aag caa tta aaa gac aag ata aaa aga taa 1248 Thr Val Tyr Leu Lys Leu Lys Gln Leu Lys Asp Lys Ile Lys Arg * 405 410 415 gatatagcaa agagaagggg atttattggt atgaaattta cagagttaa 1297 49 415 PRT Staphylococcus schleiferi femA 49 Thr Thr Ala Glu Phe Gly Ala Phe Thr Asp Gln Met Pro Tyr Ser His 1 5 10 15 Phe Thr Gln Met Val Gly Asn Tyr Glu Leu Lys Val Ala Glu Gly Val 20 25 30 Glu Thr His Leu Val Gly Ile Lys Asp Asn Asn Asn Asn Val Leu Ala 35 40 45 Ala Cys Leu Leu Thr Ala Val Pro Val Met Lys Phe Phe Lys Tyr Phe 50 55 60 Tyr Ser Asn Arg Gly Pro Val Met Asp Tyr Glu Asn Lys Glu Leu Val 65 70 75 80 His Phe Phe Phe Asn Glu Leu Ser Lys Tyr Val Lys Lys Tyr His Ala 85 90 95 Leu Tyr Leu Arg Val Asp Pro Tyr Leu Pro Met Leu Lys Arg Asn His 100 105 110 Asp Gly Glu Val Ile Glu Arg Tyr Gly Ser Asp Trp Phe Phe Asp Lys 115 120 125 Met Ala Glu Leu Asn Phe Glu His Glu Gly Phe Thr Thr Gly Phe Asp 130 135 140 Thr Ile Arg Gln Ile Arg Phe His Ser Val Leu Asp Val Glu Asn Lys 145 150 155 160 Thr Ser Lys Asp Ile Leu Asn Gln Met Asp Asn Leu Arg Lys Arg Asn 165 170 175 Thr Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Tyr Leu Asn Glu 180 185 190 Asp Glu Leu His Ile Phe Arg Ser Phe Met Glu Asp Thr Ser Glu Thr 195 200 205 Lys Asp Phe Val Asp Arg Asp Asp Asp Phe Tyr Tyr His Arg Met Lys 210 215 220 Tyr Tyr Lys Asp Arg Val Arg Val Pro Leu Ala Tyr Ile Asp Phe Asn 225 230 235 240 Ala Tyr Leu Ala Glu Leu Asn Thr Glu Ala Gln Asp Phe Lys Lys Glu 245 250 255 Ile Ala Lys Ala Asp Lys Asp Ile Asp Lys Arg Pro Glu Asn Gln Lys 260 265 270 Ala Ile Asn Lys Lys Lys Asn Leu Glu Gln Gln Leu Glu Ala Asn Gln 275 280 285 Ala Lys Ile Lys Glu Ala Glu Thr Leu Gln Leu Lys His Gly Asp Thr 290 295 300 Leu Pro Ile Ser Ala Gly Phe Phe Ile Ile Asn Pro Phe Glu Val Val 305 310 315 320 Tyr Tyr Ala Gly Gly Thr Ala Asn Glu Phe Arg His Phe Ala Gly Ser 325 330 335 Tyr Ala Val Gln Trp Glu Met Ile Asn Tyr Ala Ile Asp Tyr Gln Ile 340 345 350 Pro Arg Tyr Asn Phe Tyr Gly Ile Ser Gly Asp Phe Ser Glu Asp Ala 355 360 365 Glu Asp Ala Gly Val Ile Lys Phe Lys Lys Gly Tyr Asn Ala Glu Val 370 375 380 Ile Glu Tyr Val Gly Asp Phe Ile Lys Pro Ile Asn Lys Pro Ala Tyr 385 390 395 400 Thr Val Tyr Leu Lys Leu Lys Gln Leu Lys Asp Lys Ile Lys Arg 405 410 415 50 1284 DNA Staphylococcus sciuri femA CDS (1)…(1233) 50 aca ctg gaa ttt gaa gct ttt aca aat aaa atg ccg tac gcg cat ttt 48 Thr Leu Glu Phe Glu Ala Phe Thr Asn Lys Met Pro Tyr Ala His Phe 1 5 10 15 aca caa gca gta ggt aat tat gaa tta aaa aca tct gaa ggt act tca 96 Thr Gln Ala Val Gly Asn Tyr Glu Leu Lys Thr Ser Glu Gly Thr Ser 20 25 30 aca cat tta gta ggg gtc aaa gat aat caa ggt gaa gta tta gct gcg 144 Thr His Leu Val Gly Val Lys Asp Asn Gln Gly Glu Val Leu Ala Ala 35 40 45 tgt ctg tta aca agt gta cca gtt atg aag aaa ttt aat tac ttt tac 192 Cys Leu Leu Thr Ser Val Pro Val Met Lys Lys Phe Asn Tyr Phe Tyr 50 55 60 tca aat aga gga cca gta atg gat tat gac aac aaa gaa ctt gtt gac 240 Ser Asn Arg Gly Pro Val Met Asp Tyr Asp Asn Lys Glu Leu Val Asp 65 70 75 80 ttt ttc ttt aaa gaa atc gtg agc tat tta aaa agt tat aaa gga tta 288 Phe Phe Phe Lys Glu Ile Val Ser Tyr Leu Lys Ser Tyr Lys Gly Leu 85 90 95 ttc ttt aga atc gat cct tac ttg cca tat caa cta aga gat cat gat 336 Phe Phe Arg Ile Asp Pro Tyr Leu Pro Tyr Gln Leu Arg Asp His Asp 100 105 110 ggc aat att aaa aaa tca ttc aac cgt gat ggt tta att aaa caa ttt 384 Gly Asn Ile Lys Lys Ser Phe Asn Arg Asp Gly Leu Ile Lys Gln Phe 115 120 125 gaa tca tta ggt tat gaa cac caa ggc ttc aca act ggt ttc cac cca 432 Glu Ser Leu Gly Tyr Glu His Gln Gly Phe Thr Thr Gly Phe His Pro 130 135 140 ata cat caa att aga tgg cat tct gta ctt gat tta gaa agt atg gac 480 Ile His Gln Ile Arg Trp His Ser Val Leu Asp Leu Glu Ser Met Asp 145 150 155 160 gaa aag acg ctc atc aag aac atg gac agt tta aga aaa aga aat act 528 Glu Lys Thr Leu Ile Lys Asn Met Asp Ser Leu Arg Lys Arg Asn Thr 165 170 175 aaa aaa gtt caa aaa aat ggt gtt aaa gtt cgt ttt cta tct aaa gat 576 Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Phe Leu Ser Lys Asp 180 185 190 gaa atg ccg ata ttc cgt caa ttt atg gaa gat act aca gag aag aaa 624 Glu Met Pro Ile Phe Arg Gln Phe Met Glu Asp Thr Thr Glu Lys Lys 195 200 205 gat ttc aac gat cgt ggc gat gac ttc tat tac aat aga tta aaa tac 672 Asp Phe Asn Asp Arg Gly Asp Asp Phe Tyr Tyr Asn Arg Leu Lys Tyr 210 215 220 ttt gaa aat gta aag att cct tta gca tat ata gac ttt gaa act tac 720 Phe Glu Asn Val Lys Ile Pro Leu Ala Tyr Ile Asp Phe Glu Thr Tyr 225 230 235 240 att cca caa tta gaa aaa gaa cat gaa caa tac aac aaa gat att gca 768 Ile Pro Gln Leu Glu Lys Glu His Glu Gln Tyr Asn Lys Asp Ile Ala 245 250 255 aaa gct gaa aaa gat tta gaa aag aaa cca gat aat caa aaa acg att 816 Lys Ala Glu Lys Asp Leu Glu Lys Lys Pro Asp Asn Gln Lys Thr Ile 260 265 270 aat aaa ata gac aac tta aaa caa caa aga gaa gca aat gaa gct aaa 864 Asn Lys Ile Asp Asn Leu Lys Gln Gln Arg Glu Ala Asn Glu Ala Lys 275 280 285 tta gaa gaa gca ctt caa cta caa caa gaa cat ggt gat aca tta cca 912 Leu Glu Glu Ala Leu Gln Leu Gln Gln Glu His Gly Asp Thr Leu Pro 290 295 300 ata gca gct ggt ttc ttt att att aat cca ttt gaa gtt gta tat tat 960 Ile Ala Ala Gly Phe Phe Ile Ile Asn Pro Phe Glu Val Val Tyr Tyr 305 310 315 320 gca ggt ggt tca tcg aat gaa tat cgt cac ttt gca ggt agt tat gca 1008 Ala Gly Gly Ser Ser Asn Glu Tyr Arg His Phe Ala Gly Ser Tyr Ala 325 330 335 att cag tgg gaa atg att aaa tac gcg tta gat cac aac att gac cgt 1056 Ile Gln Trp Glu Met Ile Lys Tyr Ala Leu Asp His Asn Ile Asp Arg 340 345 350 tat aac ttc tat ggt atc agc gga gac ttc tca gaa gat gca cct gat 1104 Tyr Asn Phe Tyr Gly Ile Ser Gly Asp Phe Ser Glu Asp Ala Pro Asp 355 360 365 gtt ggc gtt att aaa ttt aaa aaa ggt tac aat gca gat gtt tat gaa 1152 Val Gly Val Ile Lys Phe Lys Lys Gly Tyr Asn Ala Asp Val Tyr Glu 370 375 380 tat att ggt gat ttc gtt aaa cca att aat aaa cca gcg tac aaa gca 1200 Tyr Ile Gly Asp Phe Val Lys Pro Ile Asn Lys Pro Ala Tyr Lys Ala 385 390 395 400 tat aca aca cta aaa aaa gta tta aaa aaa taa atgattttca gtaagagagg 1253 Tyr Thr Thr Leu Lys Lys Val Leu Lys Lys * 405 410 aatttagata atatgaaatt tacagagtta a 1284 51 410 PRT Staphylococcus sciuri femA 51 Thr Leu Glu Phe Glu Ala Phe Thr Asn Lys Met Pro Tyr Ala His Phe 1 5 10 15 Thr Gln Ala Val Gly Asn Tyr Glu Leu Lys Thr Ser Glu Gly Thr Ser 20 25 30 Thr His Leu Val Gly Val Lys Asp Asn Gln Gly Glu Val Leu Ala Ala 35 40 45 Cys Leu Leu Thr Ser Val Pro Val Met Lys Lys Phe Asn Tyr Phe Tyr 50 55 60 Ser Asn Arg Gly Pro Val Met Asp Tyr Asp Asn Lys Glu Leu Val Asp 65 70 75 80 Phe Phe Phe Lys Glu Ile Val Ser Tyr Leu Lys Ser Tyr Lys Gly Leu 85 90 95 Phe Phe Arg Ile Asp Pro Tyr Leu Pro Tyr Gln Leu Arg Asp His Asp 100 105 110 Gly Asn Ile Lys Lys Ser Phe Asn Arg Asp Gly Leu Ile Lys Gln Phe 115 120 125 Glu Ser Leu Gly Tyr Glu His Gln Gly Phe Thr Thr Gly Phe His Pro 130 135 140 Ile His Gln Ile Arg Trp His Ser Val Leu Asp Leu Glu Ser Met Asp 145 150 155 160 Glu Lys Thr Leu Ile Lys Asn Met Asp Ser Leu Arg Lys Arg Asn Thr 165 170 175 Lys Lys Val Gln Lys Asn Gly Val Lys Val Arg Phe Leu Ser Lys Asp 180 185 190 Glu Met Pro Ile Phe Arg Gln Phe Met Glu Asp Thr Thr Glu Lys Lys 195 200 205 Asp Phe Asn Asp Arg Gly Asp Asp Phe Tyr Tyr Asn Arg Leu Lys Tyr 210 215 220 Phe Glu Asn Val Lys Ile Pro Leu Ala Tyr Ile Asp Phe Glu Thr Tyr 225 230 235 240 Ile Pro Gln Leu Glu Lys Glu His Glu Gln Tyr Asn Lys Asp Ile Ala 245 250 255 Lys Ala Glu Lys Asp Leu Glu Lys Lys Pro Asp Asn Gln Lys Thr Ile 260 265 270 Asn Lys Ile Asp Asn Leu Lys Gln Gln Arg Glu Ala Asn Glu Ala Lys 275 280
285 Leu Glu Glu Ala Leu Gln Leu Gln Gln Glu His Gly Asp Thr Leu Pro 290 295 300 Ile Ala Ala Gly Phe Phe Ile Ile Asn Pro Phe Glu Val Val Tyr Tyr 305 310 315 320 Ala Gly Gly Ser Ser Asn Glu Tyr Arg His Phe Ala Gly Ser Tyr Ala 325 330 335 Ile Gln Trp Glu Met Ile Lys Tyr Ala Leu Asp His Asn Ile Asp Arg 340 345 350 Tyr Asn Phe Tyr Gly Ile Ser Gly Asp Phe Ser Glu Asp Ala Pro Asp 355 360 365 Val Gly Val Ile Lys Phe Lys Lys Gly Tyr Asn Ala Asp Val Tyr Glu 370 375 380 Tyr Ile Gly Asp Phe Val Lys Pro Ile Asn Lys Pro Ala Tyr Lys Ala 385 390 395 400 Tyr Thr Thr Leu Lys Lys Val Leu Lys Lys 405 410 52 1343 DNA Staphylococcus hominis femA CDS (64)…(1317) 52 taaaatttta aaattagtca actcaaatta aataaagatt ctaaattagg agttatagag 60 ata atg aag ttt aca aat tta aca gct aca gaa ttt ggc gat ttt act 108 Met Lys Phe Thr Asn Leu Thr Ala Thr Glu Phe Gly Asp Phe Thr 1 5 10 15 gaa aaa atg cca tat agc cat ttt aca cag atg act gaa aat tat gag 156 Glu Lys Met Pro Tyr Ser His Phe Thr Gln Met Thr Glu Asn Tyr Glu 20 25 30 tta aaa gtt gct gag aaa act gaa act cat tta gta gga att aaa aat 204 Leu Lys Val Ala Glu Lys Thr Glu Thr His Leu Val Gly Ile Lys Asn 35 40 45 aaa gat aat gaa gtc att gct gct tgt atg cta act gct gta ccc gtt 252 Lys Asp Asn Glu Val Ile Ala Ala Cys Met Leu Thr Ala Val Pro Val 50 55 60 atg aaa att ttt aaa tat ttt tat tca aat cgt ggt cca gtc att gat 300 Met Lys Ile Phe Lys Tyr Phe Tyr Ser Asn Arg Gly Pro Val Ile Asp 65 70 75 tat gaa aac aaa gaa ctc gtt cac ttt ttc ttt aac gaa tta agt aaa 348 Tyr Glu Asn Lys Glu Leu Val His Phe Phe Phe Asn Glu Leu Ser Lys 80 85 90 95 tat tta aaa caa caa cat tgt tta tat gta cgt ata gac cct tat ttg 396 Tyr Leu Lys Gln Gln His Cys Leu Tyr Val Arg Ile Asp Pro Tyr Leu 100 105 110 cct tat caa tat cgt aat cat gat ggt gat att aca gga aat gct ggg 444 Pro Tyr Gln Tyr Arg Asn His Asp Gly Asp Ile Thr Gly Asn Ala Gly 115 120 125 aat gat tgg ttc ttc gat aaa atg aaa caa tta gga tat caa cac gaa 492 Asn Asp Trp Phe Phe Asp Lys Met Lys Gln Leu Gly Tyr Gln His Glu 130 135 140 ggg ttt aca aca gga ttt gat cca ata tta caa att cgg ttc cat tca 540 Gly Phe Thr Thr Gly Phe Asp Pro Ile Leu Gln Ile Arg Phe His Ser 145 150 155 gtt tta aat tta aag gat aaa act gct aaa gat gta tta aat gga atg 588 Val Leu Asn Leu Lys Asp Lys Thr Ala Lys Asp Val Leu Asn Gly Met 160 165 170 175 gat agt tta cga aaa aga aat act aaa aaa gtc caa aaa aat ggt gtt 636 Asp Ser Leu Arg Lys Arg Asn Thr Lys Lys Val Gln Lys Asn Gly Val 180 185 190 aaa gta aga ttt ctt act aaa gaa gaa tta cct att ttc aga tca ttt 684 Lys Val Arg Phe Leu Thr Lys Glu Glu Leu Pro Ile Phe Arg Ser Phe 195 200 205 atg gaa gat aca tca gag act aaa gaa ttt tct gat aga gag gat agt 732 Met Glu Asp Thr Ser Glu Thr Lys Glu Phe Ser Asp Arg Glu Asp Ser 210 215 220 ttt tac tat aat cga ttt gat cat ttt aaa gat aga gta tta gta cct 780 Phe Tyr Tyr Asn Arg Phe Asp His Phe Lys Asp Arg Val Leu Val Pro 225 230 235 ctc gca tat ata aaa ttt gat gaa tat ctt gaa gaa ctt cat gca gaa 828 Leu Ala Tyr Ile Lys Phe Asp Glu Tyr Leu Glu Glu Leu His Ala Glu 240 245 250 255 cgt cag aca tta aat aaa gac tta aac aaa gct cta aaa gat att gaa 876 Arg Gln Thr Leu Asn Lys Asp Leu Asn Lys Ala Leu Lys Asp Ile Glu 260 265 270 aaa cga cca gat aac aaa aaa gca caa aat aaa aaa ata aat tta gaa 924 Lys Arg Pro Asp Asn Lys Lys Ala Gln Asn Lys Lys Ile Asn Leu Glu 275 280 285 cag caa tta aaa gca aat gag caa aaa att gat gaa gca aca caa ctt 972 Gln Gln Leu Lys Ala Asn Glu Gln Lys Ile Asp Glu Ala Thr Gln Leu 290 295 300 caa tta gaa cat ggt aac gaa tta cca ata tct gct gga ttc ttc ttt 1020 Gln Leu Glu His Gly Asn Glu Leu Pro Ile Ser Ala Gly Phe Phe Phe 305 310 315 att aat cca ttt gaa gtt gta tat tat gca ggt gga acg tca aat aaa 1068 Ile Asn Pro Phe Glu Val Val Tyr Tyr Ala Gly Gly Thr Ser Asn Lys 320 325 330 335 tat aga cac ttc gct gga agt tat gca gtt caa tgg act atg att aat 1116 Tyr Arg His Phe Ala Gly Ser Tyr Ala Val Gln Trp Thr Met Ile Asn 340 345 350 tat gca att gat cat ggc att gac cgt tat aat ttt tat ggg att agt 1164 Tyr Ala Ile Asp His Gly Ile Asp Arg Tyr Asn Phe Tyr Gly Ile Ser 355 360 365 ggt cat ttt aca gat gat gct gaa gat gca ggt gtt gta aaa ttt aaa 1212 Gly His Phe Thr Asp Asp Ala Glu Asp Ala Gly Val Val Lys Phe Lys 370 375 380 aaa gga ttt aat gca gat gta att gaa tat gtt ggt gat ttc gtt aaa 1260 Lys Gly Phe Asn Ala Asp Val Ile Glu Tyr Val Gly Asp Phe Val Lys 385 390 395 cct ata aat aaa cca atg tat tca cta tat aca aca ctt aaa aaa att 1308 Pro Ile Asn Lys Pro Met Tyr Ser Leu Tyr Thr Thr Leu Lys Lys Ile 400 405 410 415 aaa aag aga ttgaattaag aggggaatag tgagaa 1343 Lys Lys Arg 53 418 PRT Staphylococcus hominis femA 53 Met Lys Phe Thr Asn Leu Thr Ala Thr Glu Phe Gly Asp Phe Thr Glu 1 5 10 15 Lys Met Pro Tyr Ser His Phe Thr Gln Met Thr Glu Asn Tyr Glu Leu 20 25 30 Lys Val Ala Glu Lys Thr Glu Thr His Leu Val Gly Ile Lys Asn Lys 35 40 45 Asp Asn Glu Val Ile Ala Ala Cys Met Leu Thr Ala Val Pro Val Met 50 55 60 Lys Ile Phe Lys Tyr Phe Tyr Ser Asn Arg Gly Pro Val Ile Asp Tyr 65 70 75 80 Glu Asn Lys Glu Leu Val His Phe Phe Phe Asn Glu Leu Ser Lys Tyr 85 90 95 Leu Lys Gln Gln His Cys Leu Tyr Val Arg Ile Asp Pro Tyr Leu Pro 100 105 110 Tyr Gln Tyr Arg Asn His Asp Gly Asp Ile Thr Gly Asn Ala Gly Asn 115 120 125 Asp Trp Phe Phe Asp Lys Met Lys Gln Leu Gly Tyr Gln His Glu Gly 130 135 140 Phe Thr Thr Gly Phe Asp Pro Ile Leu Gln Ile Arg Phe His Ser Val 145 150 155 160 Leu Asn Leu Lys Asp Lys Thr Ala Lys Asp Val Leu Asn Gly Met Asp 165 170 175 Ser Leu Arg Lys Arg Asn Thr Lys Lys Val Gln Lys Asn Gly Val Lys 180 185 190 Val Arg Phe Leu Thr Lys Glu Glu Leu Pro Ile Phe Arg Ser Phe Met 195 200 205 Glu Asp Thr Ser Glu Thr Lys Glu Phe Ser Asp Arg Glu Asp Ser Phe 210 215 220 Tyr Tyr Asn Arg Phe Asp His Phe Lys Asp Arg Val Leu Val Pro Leu 225 230 235 240 Ala Tyr Ile Lys Phe Asp Glu Tyr Leu Glu Glu Leu His Ala Glu Arg 245 250 255 Gln Thr Leu Asn Lys Asp Leu Asn Lys Ala Leu Lys Asp Ile Glu Lys 260 265 270 Arg Pro Asp Asn Lys Lys Ala Gln Asn Lys Lys Ile Asn Leu Glu Gln 275 280 285 Gln Leu Lys Ala Asn Glu Gln Lys Ile Asp Glu Ala Thr Gln Leu Gln 290 295 300 Leu Glu His Gly Asn Glu Leu Pro Ile Ser Ala Gly Phe Phe Phe Ile 305 310 315 320 Asn Pro Phe Glu Val Val Tyr Tyr Ala Gly Gly Thr Ser Asn Lys Tyr 325 330 335 Arg His Phe Ala Gly Ser Tyr Ala Val Gln Trp Thr Met Ile Asn Tyr 340 345 350 Ala Ile Asp His Gly Ile Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly 355 360 365 His Phe Thr Asp Asp Ala Glu Asp Ala Gly Val Val Lys Phe Lys Lys 370 375 380 Gly Phe Asn Ala Asp Val Ile Glu Tyr Val Gly Asp Phe Val Lys Pro 385 390 395 400 Ile Asn Lys Pro Met Tyr Ser Leu Tyr Thr Thr Leu Lys Lys Ile Lys 405 410 415 Lys Arg 54 2742 DNA Staphylococcus saprophyticus femA CDS (64)…(1326) 54 acttgtttag attagaatta aactcgaaaa tagaactata gataaatagg agtatataaa 60 aaa atg aaa ttt acg aat tta act gca aaa gag ttc ggt gca ttt acg 108 Met Lys Phe Thr Asn Leu Thr Ala Lys Glu Phe Gly Ala Phe Thr 1 5 10 15 gat aaa atg ccg aat agt cat ttt acg caa atg gtt gga aat tat gaa 156 Asp Lys Met Pro Asn Ser His Phe Thr Gln Met Val Gly Asn Tyr Glu 20 25 30 ttg aaa att gca gaa agt aca gaa aca cac cta gta ggt att aag aat 204 Leu Lys Ile Ala Glu Ser Thr Glu Thr His Leu Val Gly Ile Lys Asn 35 40 45 aat gat aat gaa gta att gca gca tgt tta ctt aca gct gtt cct gtt 252 Asn Asp Asn Glu Val Ile Ala Ala Cys Leu Leu Thr Ala Val Pro Val 50 55 60 atg aaa ttc ttc aag tat ttt tat tcc aat aga ggt cca gtc ata gat 300 Met Lys Phe Phe Lys Tyr Phe Tyr Ser Asn Arg Gly Pro Val Ile Asp 65 70 75 ttt gaa aat aaa gaa ctc gta cat tac ttc ttt aac gaa tta gca aaa 348 Phe Glu Asn Lys Glu Leu Val His Tyr Phe Phe Asn Glu Leu Ala Lys 80 85 90 95 tat gta aaa aaa cat aat gcc tta tat tta cga gta gat cct tat ctt 396 Tyr Val Lys Lys His Asn Ala Leu Tyr Leu Arg Val Asp Pro Tyr Leu 100 105 110 gct tat caa tat cgt aat cat gat ggt gaa gta tta gca aat gcg ggt 444 Ala Tyr Gln Tyr Arg Asn His Asp Gly Glu Val Leu Ala Asn Ala Gly 115 120 125 cac gat tgg att ttt gat aaa atg aaa caa ctc ggt tat aag cat gaa 492 His Asp Trp Ile Phe Asp Lys Met Lys Gln Leu Gly Tyr Lys His Glu 130 135 140 ggt ttt tta act ggc ttt gac cca ata ctt caa ata aga ttc cat tct 540 Gly Phe Leu Thr Gly Phe Asp Pro Ile Leu Gln Ile Arg Phe His Ser 145 150 155 gtt tta gat tta gct gga aaa act gct aaa gac gta ctt aat ggt atg 588 Val Leu Asp Leu Ala Gly Lys Thr Ala Lys Asp Val Leu Asn Gly Met 160 165 170 175 gat agt tta cgt aaa cga aat act aaa aaa gta cag aaa aat ggt gtg 636 Asp Ser Leu Arg Lys Arg Asn Thr Lys Lys Val Gln Lys Asn Gly Val 180 185 190 aaa gta aga ttt tta ggt gaa gat gag ttg cca ata ttc cgc tca ttc 684 Lys Val Arg Phe Leu Gly Glu Asp Glu Leu Pro Ile Phe Arg Ser Phe 195 200 205 atg gaa gat act tct gaa aca aag gat ttt gac gat aga gat gac gat 732 Met Glu Asp Thr Ser Glu Thr Lys Asp Phe Asp Asp Arg Asp Asp Asp 210 215 220 ttt tat tat aat agg tta aga tat tat aaa gat cgt gtg ctt gtc cca 780 Phe Tyr Tyr Asn Arg Leu Arg Tyr Tyr Lys Asp Arg Val Leu Val Pro 225 230 235 tta gct tat atg gat ttt gat gaa tat ata aca gaa tta aag gct gaa 828 Leu Ala Tyr Met Asp Phe Asp Glu Tyr Ile Thr Glu Leu Lys Ala Glu 240 245 250 255 cgc gaa gta tta agt aaa gat ata aat aaa gca gtt aag gat ata gaa 876 Arg Glu Val Leu Ser Lys Asp Ile Asn Lys Ala Val Lys Asp Ile Glu 260 265 270 aaa aga cca gaa aat aaa aaa gcg tat aat aaa aaa gaa aat tta gaa 924 Lys Arg Pro Glu Asn Lys Lys Ala Tyr Asn Lys Lys Glu Asn Leu Glu 275 280 285 caa caa ctg att gca aac caa caa aaa ata gat gaa gcc act gcg tta 972 Gln Gln Leu Ile Ala Asn Gln Gln Lys Ile Asp Glu Ala Thr Ala Leu 290 295 300 caa gag aag cat ggt aac gaa tta ccg att tct gca gct tac ttt att 1020 Gln Glu Lys His Gly Asn Glu Leu Pro Ile Ser Ala Ala Tyr Phe Ile 305 310 315 att aat cct tat gaa gtc gtt tac tat gca ggt ggt aca tct aat gaa 1068 Ile Asn Pro Tyr Glu Val Val Tyr Tyr Ala Gly Gly Thr Ser Asn Glu 320 325 330 335 ttt aga cat ttt gct ggt agt tat gca ata caa tgg aag atg att aat 1116 Phe Arg His Phe Ala Gly Ser Tyr Ala Ile Gln Trp Lys Met Ile Asn 340 345 350 tat gct ata gat cat aat ata gat aga tat aat ttt tat ggt att agt 1164 Tyr Ala Ile Asp His Asn Ile Asp Arg Tyr Asn Phe Tyr Gly Ile Ser 355 360 365 ggt cat ttt act gaa gat gca gaa gat gca ggt gtt gtt aaa ttt aaa 1212 Gly His Phe Thr Glu Asp Ala Glu Asp Ala Gly Val Val Lys Phe Lys 370 375 380 aaa ggt ttt aat gca gat gta gta gaa tat gtt ggt gat ttt att aaa 1260 Lys Gly Phe Asn Ala Asp Val Val Glu Tyr Val Gly Asp Phe Ile Lys 385 390 395 ccg att aat aag cca atg tac aaa att tat acg aca ttg aaa aaa att 1308 Pro Ile Asn Lys Pro Met Tyr Lys Ile Tyr Thr Thr Leu Lys Lys Ile 400 405 410 415 aag gat aaa aag aaa taa acataaatag aagggaacta agctagaatg 1356 Lys Asp Lys Lys Lys * 420 aaatttacag agttaacttg tttagattag aattaaactc gaaaatagaa ctatagataa 1416 ataggagtat ataaaaaaat gaaatttacg aatttaactg caaaagagtt cggtgcattt 1476 acggataaaa tgccgaatag tcattttacg caaatggttg gaaattatga attgaaaatt 1536 gcagaaagta cagaaacaca cctagtaggt attaagaata atgataatga agtaattgca 1596 gcatgtttac ttacagctgt tcctgttatg aaattcttca agtattttta ttccaataga 1656 ggtccagtca tagattttga aaataaagaa ctcgtacatt acttctttaa cgaattagca 1716 aaatatgtaa aaaaacataa tgccttatat ttacgagtag atccttatct tgcttatcaa 1776 tatcgtaatc atgatggtga agtattagca aatgcgggtc acgattggat ttttgataaa 1836 atgaaacaac tcggttataa gcatgaaggt tttttaactg gctttgaccc aatacttcaa 1896 ataagattcc attctgtttt agatttagct ggaaaaactg ctaaagacgt acttaatggt 1956 atggatagtt tacgtaaacg aaatactaaa aaagtacaga aaaatggtgt gaaagtaaga 2016 tttttaggtg aagatgagtt gccaatattc cgctcattca tggaagatac ttctgaaaca 2076 aaggattttg acgatagaga tgacgatttt tattataata ggttaagata ttataaagat 2136 cgtgtgcttg tcccattagc ttatatggat tttgatgaat atataacaga attaaaggct 2196 gaacgcgaag tattaagtaa agatataaat aaagcagtta aggatataga aaaaagacca 2256 gaaaataaaa aagcgtataa taaaaaagaa aatttagaac aacaactgat tgcaaaccaa 2316 caaaaaatag atgaagccac tgcgttacaa gagaagcatg gtaacgaatt accgatttct 2376 gcagcttact ttattattaa tccttatgaa gtcgtttact atgcaggtgg tacatctaat 2436 gaatttagac attttgctgg tagttatgca atacaatgga agatgattaa ttatgctata 2496 gatcataata tagatagata taatttttat ggtattagtg gtcattttac tgaagatgca 2556 gaagatgcag gtgttgttaa atttaaaaaa ggttttaatg cagatgtagt agaatatgtt 2616 ggtgatttta ttaaaccgat taataagcca atgtacaaaa tttatacgac attgaaaaaa 2676 attaaggata aaaagaaata aacataaata gaagggaact aagctagaat gaaatttaca 2736 gagtta 2742 55 420 PRT Staphylococcus saprophyticus femA 55 Met Lys Phe Thr Asn Leu Thr Ala Lys Glu Phe Gly Ala Phe Thr Asp 1 5 10 15 Lys Met Pro Asn Ser His Phe Thr Gln Met Val Gly Asn Tyr Glu Leu 20 25 30 Lys Ile Ala Glu Ser Thr Glu Thr His Leu Val Gly Ile Lys Asn Asn 35 40 45 Asp Asn Glu Val Ile Ala Ala Cys Leu Leu Thr Ala Val Pro Val Met 50 55 60 Lys Phe Phe Lys Tyr Phe Tyr Ser Asn Arg Gly Pro Val Ile Asp Phe 65 70 75 80 Glu Asn Lys Glu Leu Val His Tyr Phe Phe Asn Glu Leu Ala Lys Tyr 85 90 95 Val Lys Lys His Asn Ala Leu Tyr Leu Arg Val Asp Pro Tyr Leu Ala 100 105 110 Tyr Gln Tyr Arg Asn His Asp Gly Glu Val Leu Ala Asn Ala Gly His 115 120 125 Asp Trp Ile Phe Asp Lys Met Lys Gln Leu Gly Tyr Lys His Glu Gly 130 135 140 Phe Leu Thr Gly Phe Asp Pro Ile Leu Gln Ile Arg Phe His Ser Val 145 150 155 160 Leu Asp Leu Ala Gly Lys Thr Ala Lys Asp Val Leu Asn Gly Met Asp 165 170 175 Ser Leu Arg Lys Arg Asn Thr Lys Lys Val Gln Lys Asn Gly Val Lys 180 185 190 Val Arg Phe Leu Gly Glu Asp Glu Leu Pro Ile Phe Arg Ser Phe Met 195 200 205 Glu Asp Thr Ser Glu Thr Lys Asp Phe Asp Asp Arg Asp Asp Asp Phe 210 215 220 Tyr Tyr Asn Arg Leu Arg Tyr Tyr Lys Asp Arg Val Leu Val Pro Leu 225 230 235 240 Ala Tyr Met Asp Phe Asp Glu Tyr Ile Thr Glu Leu Lys Ala Glu Arg
245 250 255 Glu Val Leu Ser Lys Asp Ile Asn Lys Ala Val Lys Asp Ile Glu Lys 260 265 270 Arg Pro Glu Asn Lys Lys Ala Tyr Asn Lys Lys Glu Asn Leu Glu Gln 275 280 285 Gln Leu Ile Ala Asn Gln Gln Lys Ile Asp Glu Ala Thr Ala Leu Gln 290 295 300 Glu Lys His Gly Asn Glu Leu Pro Ile Ser Ala Ala Tyr Phe Ile Ile 305 310 315 320 Asn Pro Tyr Glu Val Val Tyr Tyr Ala Gly Gly Thr Ser Asn Glu Phe 325 330 335 Arg His Phe Ala Gly Ser Tyr Ala Ile Gln Trp Lys Met Ile Asn Tyr 340 345 350 Ala Ile Asp His Asn Ile Asp Arg Tyr Asn Phe Tyr Gly Ile Ser Gly 355 360 365 His Phe Thr Glu Asp Ala Glu Asp Ala Gly Val Val Lys Phe Lys Lys 370 375 380 Gly Phe Asn Ala Asp Val Val Glu Tyr Val Gly Asp Phe Ile Lys Pro 385 390 395 400 Ile Asn Lys Pro Met Tyr Lys Ile Tyr Thr Thr Leu Lys Lys Ile Lys 405 410 415 Asp Lys Lys Lys 420 56 18 DNA Artificial Sequence Primer 56 ttcmaatcgc ggtccagt 18 57 23 DNA Artificial Sequence Primer 57 caagaacatg gcaacgaatt acc 23 58 23 DNA Artificial Sequence Primer 58 tgggtaattc gttgccatgt tct 23 59 21 DNA Artificial Sequence Primer 59 ccaagcatct tcagcatctt c 21 60 29 DNA Artificial Sequence Primer 60 ttctttaact gttaactctg taaatttca 29 61 26 DNA Artificial Sequence Primer 61 acatatttac ttaattcgtt aaagaa 26 62 27 DNA Artificial Sequence Primer 62 cagaaaaatg gtgttaaagt aagattt 27 63 27 DNA Artificial Sequence Primer 63 aagaaatctt actttcacac cattttt 27 64 18 DNA Artificial Sequence Primer 64 aactcgaaaa tagaacta 18 65 20 DNA Artificial Sequence Universal primer 65 gccatacagt catttcacgc 20 66 18 DNA Artificial Sequence femA primer for identification of S. aureus 66 cagcagatga catcatta 18 67 18 DNA Artificial Sequence femA primer for identification of S. haemolyticus 67 aaccgaaacg aaagaatt 18 68 21 DNA Artificial Sequence femA primer for identification of S. hominis 68 caacacaact tcaattagaa c 21 69 27 DNA Artificial Sequence primer/probe for identification of S. aureus sbs. anaerobius 69 atttaaaata tcacgctctt cgtttag 27 70 27 DNA Artificial Sequence primer/probe for identification of S. epidermidis 70 attaagcaca tttctttcat tatttag 27 71 27 DNA Artificial Sequence primer/probe for identification of S. haemolyticus 71 atttaaagtt tcacgttcat tttgtaa 27 72 27 DNA Artificial Sequence primer/probe for identification of S. hominis 72 atttaatgtc tgacgttctg catgaag 27 73 27 DNA Artificial Sequence primer/probe for identification of S. saprophyticus 73 acttaatact tcgcgttcag cctttaa 27 74 27 DNA Artificial Sequence primer/probe for identification of S. capitis 74 attaagaaca tctctttcat tattaag 27 75 27 DNA Artificial Sequence primer/probe for identification of S. cohniisbs. urealyticum 75 acttaacact tcacgctctg acttgag 27 76 27 DNA Artificial Sequence primer/probe for identification of S. gallinarum 76 acttaaaact tcacgttcag cagtaag 27 77 27 DNA Artificial Sequence primer/probe for identification of S. intermedius 77 gtggaaatct tgctcttcag atttcag 27 78 27 DNA Artificial Sequence primer/probe for identification of S. lugdunensis 78 ttctaaagtt tgtcgttcat tcgttag 27 79 27 DNA Artificial Sequence primer/probe for identification of S. schleiferi 79 tttaaagtct tgcgcttcag tgttgag 27 80 27 DNA Artificial Sequence primer/probe for identification of S. sciuri 80 gttgtattgt tcatgttctt tttctaa 27 81 27 DNA Artificial Sequence primer/probe for identification of S. simulans 81 ttctaaattc ttttgttcag cgttcaa 27 82 27 DNA Artificial Sequence primer/probe for identification of S. warneri 82 agttaaggtt tctttttcat tattgag 27 83 27 DNA Artificial Sequence primer/probe for identification of S. xylosus 83 gcttaacacc tcacgttgag cttgcaa 27